Transcript asmbl_39839

Sequence
Transcript Sequence for observation asmbl_39839 of TGE0040697:
GGGGCGGGGCGGCAGAGCTCGGTGCCCGGCCTGGAGGACAGCGGTGTCGCGAGTCGGCGATCGGTGGTCCGCGGCAACGCCGAGAGGCCGTACGGGAACGCGGGCGCCGGAGCTCAGAGGTTGACTCTTCACCACACTGAAGCCGTTAGGAAAACAAACCTTGTGGTTATCAGCAGAGCCTTCAGAGTTTCACCATAACTCAGGCCTAGACATTATTCTAAATGGCAACTGATATGTCTCAAGGTGAACTCATCCATCCTAAGGCACTCCCACTTATAGTAGGAGCGCAGCTGATCCACGCGGACAAGTTAGGTGAGAAAGCAGAAGATACCACCATGCCTATACGTCGAGCCGTGAATTCTACCCGGGAAACTCCACCCAAAAGCAAACTTGCTGAAGGGGAGGAAGAAAAACCAGAAGAACAGGAGAATGAGACTCCACCTGCTACATCCAGTGAGGCAGAGCAGCCCAAGGGGGAGCCTGAGAGTGGAGAGAAGGAAGAGAACAACAACAAGTCTGCTGAGGAACCCAAAAAGGATGAGAAGGATCAGTCTAAAGAAAAGGAGAAGAAAGTGAAAAAGACGATTCCTGCCTGGGCGACTCTCTCTGCCAGCCAGCTAGCCAGGGCCCAGAGACAAACCCCCATGGCTTCCTCCCCACGGCCCAAGATGGACGCAATCTTAACTGAGGCCATTAAGGCATGCTTCCAGAAGACTGGCGCCTCGGTGGTTGCGATTCGAAAGTACATCATTCATAAGTACCCGTCTCTGGGTCTGGAGAGAAGGGGCTATCTGCTCAAGCAAGCGCTGAAGAGAGAGTTAAACAGAGGAGTCATCAGACAGGTAAAAGGAAAAGGTGCATCTGGCAGTTTTGTTGTGGTCCAGAAATCAAAACCACCTCAGAAATCCAAAAACAGAAAGAAGGGCTCGGCTCTGGATCCAGAACCACAAGTAAAACTGGAAGATGTTCTCCCGTTGGCTTTTACTCGGCTCTGTGAACCTAAAGAAGCTTCCTACAGTCTCATCAGGAAATACGTGTCTCAGTATTACCCTAAGCTCAGAGTGGACATCAGGCCCCAGTTGTTGAAGAATGCTCTGCAGCGAGCAGTAGAGAGAGGCCAGCTCGAGCAGATAACTGGCAAGGGTGCTTCGGGGACATTTCAGCTGAAGAAATCAGGGGAGAAGCCCCTGCTGGGTGGAAGCCTGATGGAATATGCAATCTTGTCTGCCATTGCTGCCATGAACGAGCCTAAGACCTGCTCCACCACTGCTCTGAAGAAGTATGTCCTGGAGAACCACCCAGGGGCCAACTCTAACTATCAGATGCATTTGCTGAAAAAAACCCTGCAGAAATGTGAGAAGAACGGGTGGCTGGAGCAGATCTCTGGGAAGGGGTTCAGCGGCACCTTCCAGCTGTCCTTCCCCTACTACCCTAGCCCAGGAGTTCTATTTCCGAAGAAAGAATCCGGTGGCTCTGACGATGAAGATGAAGATGACGATGACGATGAATCATCAGAAGACTCTGAGGATGAGGAACCACCACCCAAGAGGAGCTTACAGAAGAAAACACCAGCCAAGTCCCAAGGGAAGACAGCCTCCATGAAGCAGAGAGGGTCGAAGCCTGCGCGGAAAGTCCCGGCTGCCCAGAGAGGGAAAGTGAGGCCGCTGCCTAAGAAAGCTCCACCCAAGGCCAAGACCCCTGCCAGGAAAGCCAGACCCTCTCCCTCAGTCATCAAGAAGCCTAGTGGGAGCTCCTCCAGAAAGCCCATAGCCAGTGCACGAAAGGAAGCGAAACTGCCCGGGAAGGGCAAATCTGCCATGAAGAAGTCTTTCAAGACAAAAAAGTAAATTTTATAGGGAAAAGGGTATCATGATTGAATTCAGAATCTTACTTTATAAGGTCAGTGTGCATTTGTTCTAGTTATAATGCTTTTAAATTGTACTTTTTCTTCCCATGTGAGCATTGTGGGAAGGAATGGACACAGAGCAGCGTAGACATTTGTGAGCTTCGGTGCTGTTCAGTGCCTGCTTCTTCATCACCTTAATTTCTGCCATAACCTGGACTTCGCTGACTGTGTGACTGCCCTGCTCCCTCTGTTCATCTTAGCCCCAGCCCTCGTCCTCTTTCTGTGATCCGATTGAGGATTTTTTCCTCCTTCAAGTTAATTTAAACAACTGCAGAGATGTGTTTGTAGAGCACTTAGAGGTCTGGGGCTGGAAGTCCAGACGGCGCAGGAGCAGTGTTGGGAAGGCTTTGCGTCCTGCCTGCAGACTTGCTAGAGCTGTGGTGATTAACCCTGGCTGTTGAATCACTCCACTGACCAGTCTCCAGCTTGAGTCGGGGACATGTTAACTTCGGAAAGAAGCCCCCGTCCCTGCCATCCCATAGATTCTGAAGGGCTCCTCTCCTCCGGTCACGCTGACCAACTGCCAAGCTCGCTTTGCTGCCCAGAGCACTGTCCCCTCACAGCAAGCACAAGTTGTCTGCACCACTTGGTTTCTGACTGAAGGGGAAGTACAGGACTACATGGAATCTGATTTCTGGTGTTGCTTATTACCAAAAATGACAGAATATTCTTGATCAAATGTCTAGATATATTTTTAATATTTGGGGCATGAGTTGTCCCTGTTTGAGAGTTCCCATTACTAATGTAGAAATGTTAAATGGTAAAACATAATTTGCTAAAATGACCAGTTTTCAGATTCACCTGTGCGTGTGCCCCCCACTCCCATCCCACCCTGTTCTTTCCATAGAACTTTTGATATCAGGCAAACGGTTTCCTTTTTGAGATATTTTAACAGAGAAGGGGTGGGGGAGAAGCAGATGAAGCTGTACTACCCAGCCCTCTTCTTGTTTGTATTTGTTTAGGGTTGTGAGGTTGTGTAAAATAGTACTAGCTTCTTACTTGAGAACTACAGTTTCTGCTTATCATTTATTCTTCCTTGTGGCACTTAATATTTTAATTGTCTTAAGCTTTTTGATGTATATATCCTCTGGCCCCTTACATGCTGCCAGAGGAGAAGGTGTTTGTTTGAGATTCATTCCACTTGAAGTGTCTCCTGGGATCCCCACAGCTGCGTATGGCTGGGAAATGGACTTAAGGCTTGGGCTTGAATTGGTGGCTCCTACCTGTGAGGTCCCATCGTGAGTCACTGGGATTTGTGTTGCATGGAAGGCAGTCTTTCCTGTTGTAAATCTTCCTTTTTTATGTACAAATATTTTGAAAAATATGAATAAACATGAACTTTTAAAA