Transcript asmbl_3926

Sequence
Transcript Sequence for observation asmbl_3926 of TGE0005318:
CGCCAGCGTCCTGCTAGCCCTGTTGCTCCCGCCACGCCGCCGGGGGCCCTCGATGACTTCTTCTCCGCGTCCGACGCAACCAGCAGCAGCGCTGCCGCCGTGTCCTTTACGACCGCCCCGTCTTCCCACGGATGTGATCTTCGTGGTGGGAACCAAGTTTCTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTTTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGCCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGATGTTGGGAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCCCGTAGTCTGCAGAAACTAGGTTTTCAGGTCATCTTCACAGATTTTAAGGTGGTGAATGTTTTGGCAGTGTGTAACATGCCCTTTGAGATCCGTTTGCCAGAATTTACAAAGAACAATAGACCTCATGCCAGCTATGAACCTGAACTTCATCCTGCCGTGTGCTATCGGATAAAGTCTCTAAGAGCTACATTACAGATATTTTCAACAGGAAGCATCACAGTGACAGGGCCCAATGTAAAGGCTGTGGCGACTGCCGTGGAACAGATCTACCCGTTCGTGTTTGAAAGCAGGAAGGAGATTTTATAACTCAAACTTGGTTGGTTAGTCTCCACCTGAGCACCGTTTGAGACCTGCTGCACATTGGACTCAAAACACAAGGAAAACTGGACCAACAGTGACCGAGGACAGACTCGGACTCACAGCTGCAGTGTAAGCTCCAGTCCCTTTGGATTTTACTTCAAAGTTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACATTGCTGCTTTTACAAAAGGACGTTCTATTT