Transcript asmbl_3924

Sequence
Transcript Sequence for observation asmbl_3924 of TGE0005318:
TTTATTGTCGCGGGGGAAGCGGCGGCCGCCCTGTACCCGGAACAACAAAGCGAGAAACCGAGCTCGAGCCTTGGGGGGCTCCTAGCAACGGGCCTGGGCGGGAGTTCCATGGAGACTGGGGAGCGGACCCGTTTTATCTTCATCCTTGTCCTCCAGCTTCTTCTCCGCGTCCGACGCAACCAGCAGCAGCGCTGCCGCCGTGTCCTTTACGACCGCCCCGTCTTCCCACGGATGTGATCTTCGTGGTGGGAACCAAGTTTCTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTTTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGCCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGATGTTGGGAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCCCGTAGTCTGCAGAAACTAGGTTTTCAGGTCATCTTCACAGATTTTAAGGTGGTGAATGTTTTGGCAGTGTGTAACATGCCCTTTGAGATCCGTTTGCCAGAATTTACAAAGAACAATAGACCTCATGCCAGCTATGAACCTGAACTTCATCCTGCCGTGTGCTATCGGATAAAGTCTCTAAGAGCTACATTACAGATATTTTCAACAGGAAGCATCACAGTGACAGGGCCCAATGTAAAGGCTGTGGCGACTGCCGTGGAACAGATCTACCCGTTCGTGTTTGAAAGCAGGAAGGAGATTTTATAACTCAAACTTGGTTGGTTAGTCTCCACCTGAGCACCGTTTGAGACCTGCTGCACATTGGACTCAAAACACAAGGAAAACTGGACCAACAGTGACCGAGGACAGACTCGGACTCACAGCTGCAGTGTAAGCTCCAGTCCCTTTGGATTTTACTTCAAAGTTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACATTGCTGCTTTTACAAAAGGACGTTCTATTTATTTTCGCAGTAATCTCCATGTCCCACAGGCAGAGCTGTCGCAGTGTGCACTTCCCGACAGTTGTTTTATTGATGTCATTATTTTTCCAGTTGGAGCTAATGTGTTTGATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAACGTTATCTTTTTAAATTGAATGTGCACAAATAAAAGTTTGGAAAAGATCTCTCTTCATATCCATTCTGTAACTTTTATTCACCATTTTTTTCTTTTAAACAACTGTATTCATAATTTTTTTTAAATCTATGCAGGCTTAGACTTTGGCTAAAGTGTGTGGGCTTCTTTTTGAAGTGAGTTTGTATATATTTGTGTGTATGCTACATGTATATAGTATCTTTTCATGCTCTGTTACCAAATATCAATTAGAATGTTCTCCTCGCAGATTGGAAGTAAAAACCATGTATATAAGCTCTAGGTAACTAGGGTAGAACTCCACAGGTAAATGATAATGTTTGTGTTACTAATTTAATATGATAGAAAATGTTAAATGCGTTTGAAAAGCTAAGAGGTTGTAGTTTTGAAGAGAGGCCTTTTCCTGTCTAGGTGGATCTGCAGTAGCCCCGTAACCCTTGTTATTCTGGAAAGCTGGCTGTAGATGAACGAGCCAGCAGAGGTTCTTAACTACCCTTAGGTCGGTGCTCAAGGCTATGCTGGTCTTGTCAGAAATTGACTGACATTGTGTTTTAACAAGAAGTGGCTCGACTTGACCCAAAGCCTCTGGCAAGCTGGTCTCTGTCCTCGCCGTGTCTGAGTAGTGCATGTGAAGGGTGACTGGAGGATTAAGAGAGGCCACTCTTAAACTTCAGTTCCATGAGACAGGGCCTCAGCCGTGCATGGGCTCTGGGTGGAAAGGCATGGTCGGACAGGTGCTTAGTGTAGCCAGGAGTGGCTTTACCTACCAATAAACTAGGTGGAGTCAAAACTTAGATTCTCTGTACAGACGAAACTATTTCCCACCAAGCTCTGACTTACTGTTGTATTTTTGAAATGTTTGCAAAGGCTTGTGACATGTGCACCATATTACAGACCTTCCAAGGCTAACTTAAGCACTGGCTGGGCAG