Transcript asmbl_65743

Sequence
Transcript Sequence for observation asmbl_65743 of TGE0007108:
ATCGGCTCCTCCGAGGAAGGGGGCGGTTGGAGTGGTCTCCATTGTTCGCGGCTTAGGGCGCCATGAGGGGTGACCGAGGCCGAGGTCGCGGAGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTGCCGCACATCCCGTTTGATTTCTATTTGTGCGAGATGGCCTTCCCCCGGGTCAAGCCAGCGCCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTTGCTCCTAATTCTGCTGAACAAGCCTCTATCCTTTCTCTGGTGACAAAAATAAACAACGTGATTGACAATTTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCTTATAAAAAGGGAACGATGACCACGGGGCACAACGTGGCCGACCTGGTGGTAATCCTAAAGATTCTGCCAACGTTGGAAGCTGTCGCTGCCCTAGGGAACAAAGTCGTGGAGAGCCTCAGAGCGCAGGACCCTTCTGAAGTTTTGACCATGCTGACCAACGAAACTGGCTTCGAGATCAGCTCGTCTGACGCGACGGTGAAGATCCTCATCACGACAGTGCCGCCCAACCTCCGGAAACTGGACCCAGAACTCCACTTGGACATCAAGGTGTTGCAGAGTGCCCTAGCAGCCATCCGGCACGCCCGCTGGTTTGAGGAAAATGCCTCTCAGTCCACAGTTAAAGTTCTCATCAGACTGCTGAAGGACCTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTCGACCTACTCGGGCACTATGCCGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTGGCATACAGGCGCTGCTTGCAGATCCTGGCCGCAGGACTGTTCCTGCCAGGGTCGATGGGCATCACGGACCCCTGTGAGAGTGGCAACTTCAGAGTACACACAGTCATGACTCTGGAACAGCAGGACATGGTCTGCTACACGGCTCAGACGCTGGTCCGGATACTCTCGCATGGTGGCTTCAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTGACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAAGAAGAGGAGGAGAATGCAGAAGAACCACCTCCGGGAGAGGAGGAGGAAAGCATGGAGACGCAGGAGTGACCTTGCCTTCACCCTCTTTCTTACCCAAGGGGAAGGAAGACCGGAGCCTAGGCTAACTGCCACTGGGCTTTATATGGTGGCATTTCTGAGGGATGGGGAGACGGGGGAAAAAAAACTCTATGGAAGGAAGTGTCGTCCCACAGACTTCTGCCGTTGGCCTAGTAGCCAGAAGTCCCCCAGTGAAGCAGGATACCAACTTTTCTTCCTTAATACTGTAAACTCCCCAGCTTCCAGAAACCTCTCAACCAGTACTTTGTTGTTGAAATGTGAACTGTTGATGTCTGGAAATTTTTTTCTAGGAAAAATGATTAAAGTACTTCCTAGTA