Transcript asmbl_36457

Sequence
Transcript Sequence for observation asmbl_36457 of TGE0002736:
CTTTCTGAGCCCCGGCGGTGCGCGCTACGGAGCTCGGCCAGCCTGCTCCGTCCTGACTCACCGCTGTTCGCTCCTGCTGAGGAACAAGTCGGTCAGGAAGCCGCGCCTCAGCCATGGCATTTAAAGATACCGGAAAGACGCCCGTGGAGCCCGAAGTGGCGATTCACCGAATTCGAATCACGCTCACCAGCCGCAACGTGAAGTCGCTGGAGAAGGTTTGTGCGGACTTGATCAGAGGCGCCAAGGAAAAGAATCTGAAAGTGAAAGGACCGGTGCGCATGCCTACCAAGACTTTGAGAATCACTACCAGAAAAACACCTTGTGGTGAAGGTTCCAAGACCTGGGATCGATTCCAGATGAGGATCCACAAGCGACTCATTGATTTACATAGTCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCGGGAGTTGAGGTTGAAGTCACCATTGCAGATGCCTAAGACAACTGAATAAATCGTCTTAATGGTCAAA