Transcript asmbl_65544

Sequence
Transcript Sequence for observation asmbl_65544 of TGE0007081:
AGTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACATCGGTGGGCACTAACCGAGCCCGGGGAAACTGGGAACAGCCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGCAGAACAAATTCGACTTGCACAGATGATTTCGGACCATAACGATGCTGACTTTGAGGAAAAAGTGAAACAATTGATTGATATCACAGGCAAGAACCAGGATGAATGTGTCATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCCATCAATGTACTGCTGGAAGGAAACCCAGATACGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTTTCAGGACAGAAGGATGGTGGCCAGACGGAGTCCAACGAGGAAGGCAAAGAAAATCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGTGGGCGAGGTGCCAGCCGTGGACGAGAGTTTCGGGGTCAGGAAAATGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACAGAAAGAGGGCGAAGAGGTCGCGGACGAGGCAGAGGTGGCTCCGGTAGGCGGGGAGGAAGGTTTTCTGCTCAAGGAATGGGAACCTTTAACCCAGCCGATTATGCAGAGCCAGCCAATACTGAAGATAACTATGGCAATAATAGCGGCAATACGTGGAACAACACTGGCCACTTCGAGCCAGATGATGGGACGAGACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTGGTGCGTGGAGGACTGCAACCGAGGAGTGGGGAACTGAAGATTGGAATGAAGATCTTTCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCAGAGAATGTGACAATCACTGCTGGTCAGAGAATTGACCTTGCTGTTCTACTGGGGAAGACACCGTCTTCAATGGAGAATGATTCCTCTAATCTGGATCCATCTCAGGCTCCTTCTCTTGCCCAGCCTCTGGTTTTCAGTAACTCGAAGCAGAGCACCATATCACAGCCTGCTTCAGGGAGCACGTTTTCTCATCACAGTATGGTGAGCATGTTAGGGAAAGGATTTGGTGATGTCGGCGAAGCTAAAGGCGGCAGCACCACGGGCTCCCAGTTCTTGGAGCAGTTCAAGACTGCGCAGGCCCTGGCTCAGCTGGCCGCCCAGCATTCCCAGTCCGGAACCGCCACCACCTCCTCTTGGGACCTGGGCTCCACCACGCAGTCCCCTTCGCTGGTGCAGTACGATTTAAAGAACCCAAATGATTCAACAGTGCACAGCCCCTTCACAAAGCGCCAGGCTTTCACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAGAAGCCACCTGCAGCAGCTACCTCCACAGCTGCACCTGCACCCCCCTCTTCTCCGCTGCCAAGCAAACCTGCCTCGGCGCCACAAATGTCCCCTGGGTCTTCAGACAACCAGTCCTCCAGCCCTCAGCCGGCTCAGCAAAAACTGAAGCAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCGGCAGATATCTCAGGGCTAAACCTGCAGTTCGGGGCCTTGCAGTTTGGGTCGGAGCCTGTCCTTTCTGATTACGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCCGAGTAGCCTCTATACCAGCACGGCCAGCGAGTCTTCGTCCACAACGTCATCCAACCAGAGCCAGGAGTCCGGGTATCAGAGTGGCCCAATTCAGTCAACAACCTATACCTCCCAAAACAGTGCTCAGGGCCCTCTGTATGAACAGAGATCCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCATCACCCCAAAAGGACCTGACTCAGGCAAAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACGCAATCTGTCGAAGGTGCTACAGGCTCTGCCGTGAAATCTGACTCACCTTCCACTTCTAGCATCCCCCCACTCAGCGAAACGGTCTCTGCAGCCTCCTTACTGACGACGACCAATCAGCACTCGTCCTCCCTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACTGCCACCACACAACACAGCAGCACGTTGTCCACGCAGCAGAACTCCCTGTCCACATCAGCATCTTCCGGGCGCACTTCGACGTCCACTCTTCTGCACACGAGCGTGGAGAGTGAGGCGAATCTCCATTCTTCCTCCAGCACTTTCTCCACCACGTCCAGCACGGTCTCTGCACCCCCCGCAGCGGTCAGCGTCTCCTCCGGTCTCAGTAGTGGCAGTAGCCTGGGCCTCAGCCTCGGCAGCAGCTCCACCGTCACGGCCTCGACACGAAGCTCAGTTGCCACGACTTCAGGAAAAGCTCCTCCTAACCTCCCGCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTACATCATGGCTCCGGGGCTGTTACATGCCTACCCGCCCCAAGTGTATGGTTATGACGACTTGCAGATGCTTCAGACGAGATTTCCGTTGGATTACTACAGCATCCCGTTTCCCACGCCCACCACGCCGCTGACTGGGAGGGACGGTAGCCTGGCCAGCAACCCTTATTCCGGTGACCTCACAAAGTTCGGCCGCGGGGATGCCTCCTCCCCGGCCCCGGCCACAACCTTGGCCCAGCCCCAGCAGAACCAGACGCAGACACACCACACCACACAGCAGACGTTCCTGAACCCGGCGCTGCCTCCCGGCTACAGCTACACCAGCCTGCCGTACTACACAGGGGTGCCGGGGCTCCCCAGCACCTTCCAGTACGGGCCTGCCGTGTTCCCTGTGGCTCCTACCTCTTCTAAGCAGCATGGCGTGAACGTCAGCGTGAATGCATCGGCCACCCCCTTCCAGCAGCCAAGCGGGTACGGGTCTCACGGATACAACACTGGAAGAAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGGCTGGGGGCTGTGTTTTGTGTGTGTGTATGTTTGCACTGAAGTCTTGTTTCAGAAACCAGAGCACTGAGGAGAGCCTGCCGAGCTGTGGCCACGGCCTGCGTGGCTTGGGGAAATGAGTTGGTGGATGCCTTCTGGGCTCTTGAACTTGCCCGTCCCCCGCTTCCCCTCCTCCATGTGTCTGACCCTGTCTTACCCATTTCGAGTCCGAGCGGTGCAGCACCTCCGAAGCATCGATGCACACACACCCGCTGTTGCTTTTAATTTCTGGAAGGCATGTGGTTGCAACTTGTAACAAAAACCTTTGTAGTCTTCAATAAACTGTGGTGTTTCTTTA