Transcript asmbl_65516

Sequence
Transcript Sequence for observation asmbl_65516 of TGE0007072:
CGGCTTCCAGGAACAGGTGAGAGGGTTTGTGACCGGCTCTCGGAGACTGCGGGTGGGGATGTGGCCTTACCTCTGTAGCACAGGGGGCCCGGCCTGTTGCGTCGGAGTCCCCCCCCGTGTTTGGGGTCGATGGGCCCGACTGGCTGACCCTCTGGATACGCGGAAACTCCCGAGCTCTGTCGTGAGCTTTCTAGGCACCCCTAATATGCCCGATCCCGGGTTGCTCCTCTACGACGCGCCCTCCTTCCTCGCCCGGCGTTGCTCCGGGGCTGTCTCCGCTGTCCCGGCGACCACTGTGGGGCTCGGGGCGCCCAGTCTCAGCCCCAGGCTACATGCCGTAGCACGCAGGGGTTCCGGCTCCATTTCTTCTCTTCTTGGGGGCGAGCCCGCACCCCTTTCACCGCCTACCAGGGAAGACCTGGGTTCTAGACCTGTCGCTGCCACTGCCGTCGTATCTCCTTACCTTCTAGAACCTCACTTTGACCAATAAAATAGGGTTACTTAAGGGTCCTCTCAGGCCCTAGTCCTGAGGTACTTTGCTCTTTCTCCAAGACTTGGAGGAAGAAGCCGAGAGTAGCAATTCCAGAGGCTCCCTGGAGGAGGAGTTGGCGGGCGAGGAGGATAACATGAGGTGGCATTAAGTTCTAGCCATCTGTTTTAAGTGTGATCAGTGGAGTCTCAGCCACCCAGCCATCCTTTTGGTTCACTGCATTTCCTTCTTTCTGTAAATGCTCTGAAGCTCAGTCCAGAAGAGGGCGGGGCCAGGGTCCAGAAGTAAAGGGCTAGGGGTGTGTGTATGGGGGTGACCTGGGGAGCTGCCACCGTGTATCTGCCTTTGGTGCTTGCCCCTGCAGGGAGTGCTGGGTGCTTCCTCCCTATGCCACCCCCACATGATGCCCCTGTCCCGCTGGCTGAGGTCTGTGGGGGTCTTCTTGCTGCCAGCCCCCTGCTGGGTACCCCGGGAGAGGTGGCTGGGTACCCTGCGGCGGCCCTCCCTGGTGTATGGGGGCTCAGTCCTGGGGGCCTGGCACAGTGCCGGCTGCTGGTGCCAAGCGTGGACAGAGGAGCCTCGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTCGC