Transcript asmbl_34075

Sequence
Transcript Sequence for observation asmbl_34075 of TGE0001954:
GGCTGCAGGGTCCTTGGTGCTGTGGCGGTGTGGTTGATTAGGGTGCTGCTTTCAATCGTGTGGCCTTTGGGAACCCCGCGTAGCCACTGCCGCCTCCTTCTGTCCTCGCCATGTTCCTCACTCGGTCCGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGCATCCAGACCTCAGAGGGTGTATGTCTAGCTGTGGAGAAGAGAATTACCTCCCCACTAATGGAGCCTAGCAGCATTGAGAAGATTGTAGAGATCGATGCTCATATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAAACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTATAATGAGACAATGACAGTTGAGAGTGTGACCCAGGCTGTGTCCAATCTGGCTCTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCTATGTCTCGTCCCTTTGGAGTAGCATTGTTGTTTGGAGGAGTTGATGAGAAAGGACCCCAACTGTTTCACATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCTGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCATAAGTCTATGACTCTGAAGGAGGCCATCAAGTCCTCGCTCATCATCCTCAAGCAAGTCATGGAGGAGAAGCTGAATGCAACCAACATCGAGCTAGCCACGGTGCAGCCTGGTCAGAATTTCCACATGTTCACAAAGGAAGAACTGGAGGAGGTGATCAAGGACATTTAAGAAGGAGCCGTCCTCGAACTTCTGTGGGACACTTTCAGTTCTAATTGCCCTTAGACTTTATTTCCAGCTCTTATGTCATGGAAAATATCCAGTATATGTGTGTGTGTTTTTTTATGAAGTCTGTACATAACAGCAATTCTGAAATAAA