Transcript asmbl_64292

Sequence
Transcript Sequence for observation asmbl_64292 of TGE0007020:
GTTCTTGGTCTGCAGCCGCTGCTGCCACCTCTTACCAGCGCCGTTGCTGCGGGGGATTGTGGGATCCTTCGCGTCCTGTTCGCTAGGAGAGAGGTACCTCTCCTTTTCCCTTTCCCTTTCCTTAAGAGTTGTCTGCTGGTTCTCAGCTTGAAGAAGATTCTACAGTCCTTATTGATCCTTTTTCTTGGCGTTACCATTTTTTTGAAGCAAAGTTGACCTAGTTTTGTAGTTTGAGCTTTCTTTTTGGCCATCTTTTAAGAAAATTTTTTTGGTAATCTATAAATTAGCCAAGAGATAGTTCTACAATGTCCAAGTCATTCCAGCAGTCATCTCTCGGTAGGGACTCGCAGGGTCATGGGCGTGACCTGTCTTATAGGCCTTCTTGCTGCTGCTACCCAGTCTTTAAGTATGCCAGCATCTCTTGGAAGGATGAACCAGGGTACTGCACGCCTTGCTAGTTTAATGAATCTTGGAATGAGTTCTTCATTGAATCAACAAGGAGCTCATAGTGCACTGTCTTCTGCTAGTACTTCTTCCCATAATTTGCAGTCTATATTTAACATTGGAAGTAGAGGTCCACTCCCTTTGTCTTCTCAACACCGTGGAGATGCAGACCAGGCCAGTAACATTTTGGCCAGCTTTGGTCTGTCTGCTAGAGACTTAGATGAACTGAGTCGTTATCCAGAGGACAAGATTACTCCTGAGAATTTGCCCCAAATCCTTCTACAGCTTAAAAGGAGGAGAACTGAAGAAGGCCCTACATTGAGTTATGGTAGAGATGGCAGATCTGCTACACGGGAGCCACCATACAGAGTACCTAGGGATGATTGGGAAGAAAAAAGGCACTTTAGAAGAGATAGTTTTGATGATCGTGGTCCTAGTCTCAACCCAGTGCTTGATTATGACCATGGAAGTCGTTCTCAAGAATCTGGTTATTATGACAGAATGGATTATGAAGATGACAGATTAAGAGATGGAGAAAGGTGTAGGGATGATTCTTTTTTTGGTGAGACCTCGCATAACTATCATAAATTTGACAGTGAGTATGAGAGAATGGGACGTGGTCCTGGCCCCTTACAAGAGAGATCTCTCTTTGAGAAAAAGAGGGGCGCTCCTCCAAGTAGCAATATTGAAGACTTCCATGGACTCTTACCGAAGGGTTATCCCCATCTGTGCTCTATATGTGATTTGCCAGTTCATTCTAATAAGGAGTGGAGTCAACATATCAATGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCGTTCATGTTGCAGCAGTCTACAAACCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCGTTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTAGGTGCTGGAAATGGGAACCTGCAAGGACCAAGACACATGCAGAAAGGCAGAGTGGAAACTAGCCGAGTTGTTCACATCATGGATTTTCAGCGAGGGAAAAACTTAAGATATCAATTATTACAGCTGGTGGAACCATTTGGAGTAATTTCCAATCATCTGATTTTAAATAAAATCAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGGCTGCAGTGGATTACTATACAACCACACCAGCATTAGTATTTGGCAAGCCAGTGAGAGTTCATTTATCCCAGAAGTATAAAAGAATAAAGAAACCTGAAGGGAAGCCAGATCAGAAGTTTGATCAAAAGCAAGAGCTTGGACGAGTGATACATCTCAGCAATTTACCTCATTCTGGATATTCTGACAGTGCTGTCCTTAAGCTTGCTGAGCCTTATGGGAAAATAAAGAATTATATACTGATGAGGATGAAAAGTCAGGCATTTATAGAGATGGAGACCAGAGAAGATGCAATGGCAATGGTTGACCACTGTTTGAAAAAGGCCCTTTGGTTCCAGGGGAGATGTGTGAAAGTTGACCTGTCTGAAAAATATAAAAAATTGGTACTAAGGATTCCCAACAGAGGCATTGACTTACTGAAAAAAGATAAATCCCGAAAAAGATCTTATTCTCCAGATGGCAAAGAATCTCCTAGTGATAAGAAATCCAAAACTGATGGTTCTCAGAAGACTGAAAGTACAAATGAAGGTAAAGAACAAGAAGAGAAGTCAGGTGAAGATGGTGAAAAAGATACAAAGGATGACCAGACAGAACAAGAACCTAGCATGCTTCTTGAATCCGAAGATGAATTACTCGTAGATGAAGAAGAAGCAGCAGCACTGCTAGAAAGTGGCAGTTCAGTGGGAGATGAAACAGATCTTGCTAATTTAGGTGATGTGACTTCTGATGGGAAAAAGGAACCTTCAGACAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCTGCAAAGAAAAAGCTTAAAAAGCGTCGTTTCCCAGGGAGTATGGAAGGTTTTGTCACTCTAGATGAGGTTGGTGATGAGGAAGATTCGGAACTTCAGAAACTTCGTAAATCGGGCATGGCATTTAAATCTGGTGACAAAAATGATGATGGTTTGGTTGAAATTAAGGTGGACAAGATCGAGGAACTTGATCAAGAAAATGAAGCAGCGTTGGAAAATGGAATTAAAAATGAGGAAAATACAGAACCAGGCGCTGAATCTGCTGAGAATGCTGATGATCCCAACAAAGATACAAGTGAAAATGCAGATGGCCAAAGTGACGAAAACAAGGAGGACTATACAATCCCAGATGAGTATAGAATTGGACCGTATCAGCCCAATGTTCCTGTTGGTGAGCTTTAAGGCTTTGTTCTTCCCCTCGCACCCTCCCCAAACTCTTATTAAATAAGATTTTTAAATTGGTCTTAACATGAGTTCTGATAGTGTTTCAAATTTATTTCTGTACAAAACAATTTGTAAATCTTGAGTGATGCATTCTCTTTTCTTATCTAAGTCTCCTGATTTTGTATTATCTTTTATCATTACACAATATGTTCTCTTTTTCCCTCATAAAGGTTTCTGAGAATTTCACATTGCCTTTTATTTTGTTTACCTGTTATATTTCTGCCTTTTTAAGACTATAAAATAGGTGGAACCTTACACAACAATTAAACACAATTCTGTTAACTAATGCTGTTTTTTTGTTTGATTTTGTTTTACCTTAGGCTATACTGGACTTCTCATAAATGTTATCTCATTCAGATTATACTGACAGGAAAAAAAGATTTGAGAACACTAATTAAAATACTCAGTTTACTGAATTTGTAAGAATGTATGTTTGTGTTCTAGGTATAGACTATGTGATACCTAAAACAGGGTTTTACTGTAAGCTGTGTTCACTCTTTTATACAAATGAAGAAGTTGCAAAGAATACTCATTGCAGCAGCCTTCCTCATTATCAGAAATTAAAGAAATTTCTGAATAAATTGGCAGAAGAACGCAGGCAGAAGAAGGAAGCTTAAGATGTACAAGAATCTTAATGATTTCAAAAGAAAATAATGGTTCTTTGTTTTTAATGTTAACTTTTTTAAAATACAATACTGATAGTTAGAAGAAAACTATTGTACTCTTTTGTTTTAGTGGAAAAATAATAGATGTCTGTTCATGTGTTAAGTGTTATAGCAAAAATGCATATACGGTTAAGTTAATGAAAAATTGTTTTTGTTTTATCGAAATGGTAACAGACAGAAGTACTTGTAGAGACTGACTTCGTAAACTACTTAAGACAACTTGCACCACTAAGAAAAAGATACGTAGAACTATTCAAAGAAATGAAATTTAGTAGTTCTAAGCTTCAAAGAAATGTCAAAACTTTTGATTCCATTCAATAAAGAACAAAACCAATTGTATTTTTATTACTTTCATCTGAAACATTCCACATTTTAATCTGAGCCTTGTAGACTTCTCATTTGGAGTTTGAAGCTTTTTTGGTTACATTTCATTTTCGGAGAACTTCATTAATGTGTGATTAGCAATTAAAATGCAGGTGCAGTTTTCTTTTAATGTTATGCTGTTGCTTAGGTAATAAGAAATATTAAGTAATTGGCTTTAGATTTTGTAATTTTTTCCCCTAAGTTCCTGCTAGATTTCGTATTCTAGTAGTCAATGTATTTTCAGTGAAATGTAAAAATACTCCCATTCTCTTTGACCAGTATTAATTTCTTGAAACCTTATTGCTTGTCACTTGAATCCTATAGCTGTCATACATCTGGTATAAGCAACATTTGATTTTTGAAGTGTGTAGACCATCTCTTCATATTTTCAAGATGTAATTTTACATTTCTGCATTTTAAAAAGTTTGGCCATAAGCTAGACGCACGCTTCTAATTCATATACCTGCACATGTGATCTTTGTGAACAGAAATTTGCATGTATAATCTGTGTTTACTTGTAACTTTCTGGTTATATACTGCTTATATCTGTGGATTCAAGTTTCTGAAGTGAATACCAATAAAAAAAAAACCTAGGCCATGTTCATTGGTTATACATGTTTGGAATGTTAACCAATATATTGTCAGTTGTGGTTTTTATTCACTGTTACACTTTTGCATGCTTTAACAAATTTTTACATTTTCAATCTAGAGTGTTCTGAAGATTGCTACTAAAGATATGAATTTTAAAGTTTTTGGTGCTGGTGGATTTCTTGTTCCTGTTACATAACAAAAGTGGGACTATTGGTTTTTTTAAACCTCAGGAGTTATAAATGCTAAAGACAAATAGCAAATGCTAATGTTTAGACATGTCGAAGTAGTTAACAGTAAAATTGAAAGTAACATGGTGGAATAGTAAGAATTCTAGCAGCCTTTCAAAATGTTGGGGGTCTTAGTATAAGGGAGTATCAGTTCTCAAATTTTTTTTAATTTAATAAGAACTTACAGGAATTCTTTTTGAAACTCTTAGTTCCAAGTGTATTAAAGGATATTT