Transcript asmbl_29484

Sequence
Transcript Sequence for observation asmbl_29484 of TGE0006790:
CGGGTGTTTGTGTGTGTGTATGTGTTGGTGACTGTGAGTACGGAGGAGCAGCGGCCGCCATTTCAGGGAGCTAGCCGACGCTGTCGCAGGGGTGGATCCTGAGCTGCCGAAGCCGCTGCCCTGCTCTCCGTCGCGGGCTCCTTTAATCCCATTGTTTCTTTTAGATTCGCTTGGGCCTAGACGCCCTCGGGGCCCGATATTCGGGTTGGGCGGTACCGCGGCCTGGGCCTAGTGGCTTAACAGTAGCGACAGCAGCAGCGGCGGCGGCGGCGGCAGCCGACTTCCCGTGGCGAGCACAGGCGCGCGGAAGCCCGCACAGGCGAGTAGAGAAAATGGCAGACGATATTGATATTGAAGCCATGCTTGAGGCCCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAACAGTGCTAACGGCCATGAAGAACGTAGCAAAAAGAGAAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAGAGAAAAAGAAGCAAAAGTAAAGAACGGAAAAGAAGTAGAGATAGAGAAAGGAAAAAGAGCAAAAGTCGAGAGCGGAAACGAAGTAGAAGCAAAGAAAGGAGACGAAGCCGCTCACGCAGTCGGGATAGAAGATTCCGAGGCCGCTACAGAAGTCCCTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGATTGCCTCATAGCATCAAATTAAGCAGAAGACGTTCCCGAAGCAAAAGTCCATTTAGGAAAGACAAGAGCCCTGTGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGACTGTTTTCTGCATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAGATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCATCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGGAAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAATGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACTAGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACCGGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGGCAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACCTCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGCATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATACAGTCCCTTATGTATATAGCTTTTTTTTCTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAACTCCTGTTACCTTGAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTATCCCTAACTAGCAAATCCTACTTTATGCAAAGCTGTTCTCTTGTTCTGCTGTTTTAAATGTCCATGTAGAAAATGACATTAAGGATCTATAGAATAGCTCTAGGGGAACAAATGTGCTTTCTGTATAAAGGCAGACAGGTCACGTTTTAATGTTTCAGAAACCTAACTTTTTACACAGCAGTTACAATTCACATTCATGTATTTGGCTCATGGTTCAGCAAAGGTTTCCAGAATCCACATTTAGTGTGTGAAAAGTCTAAGTGGCTGTATGGCTGCTTGGCATTTGATCTTGATTATTTGGCAAGAATGGGATTTCAAAATAATATTTCTCGATGGTAATTTTTTCAATTAATGTCTCTGTAAAAGTTTCTTTGTAAATACTGTATGTTTTAGTGTGTCTTGAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGGTGGCTGACGTAACAGATTGAGTAAGCAGTCTTGGGCAAGAGATGGGAAATGCAGAAAAAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTGAAAAAGGC