Transcript asmbl_28029

Sequence
Transcript Sequence for observation asmbl_28029 of TGE0032877:
CGGGACTAGAAGAAACGGCGGCCGGGAGGGGGCTACGGGATCATGGGGCTTCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCGAGAGCTGCGGCTGCTCATGCTTGGCTTGGACAACGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAAGACGTGGACACCATCTCCCCGACACTGGGCTTCAACATCAAGACCCTGGAGCACCGCGGATTCAAGCTGAACATCTGGGATGTAGGTGGCCAGAAGTCTCTGCGCTCCTACTGGAGGAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCCGACCGCCAGCGCATGCAGGACTGTCAGCGAGAGCTGCAGAGCCTACTGGTGGAGGAGCGCCTGGCTGGAGCAACCCTCCTCATCTTTGCCAACAAGCAGGACCTGCCTGGAGCACTGTCCTGTAATGCTATTCAGGAGGCCCTGGAGCTGGACTCCATCCGCAGCCACCACTGGCGCATCCAGGGCTGCAGTGCTGTCACAGGGGAAGACCTGCTGCCTGGCATCGACTGGCTCCTTGATGACATTTCCAGTCGTGTCTTTACTGCCGACTGAGCTTCTTCAGTGTCCCCAGGTCCCTGTCCTCATCAGACACCAGCCAGAGGGATGAGCACCAGCTGGCCAGACTAACACTCCCAACCCCACCATGACCTGCTGCTGCTATTACTGCCCATTGCTGCTCCCCCGGGTGAGGGCTGTCACCCTGTCTCCCAAAGTGGCCTGCAGCTGCCATGCCAAAAGGAAAGGCTGGGCTGGGAGGGACTACCTGCTGCTGCCAGGGTCCTAGGTGTCGCCTCGCCTCGGTCCAGCAGTGAGAATAAAGCACTCTTCAC