Transcript asmbl_63977

Sequence
Transcript Sequence for observation asmbl_63977 of TGE0006979:
GGCGAGGGGAGGCGGCGGCCGCGGCCAGCGCACCATTCGCTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGTCGCGGGCGAGCGGGAGCAGAAGGAGGGAGGGACGCCGCCGCTGCAGCCACCGCCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTTCTTATCAAGGGAGGCAGAATCGTCAACGATGATCAATCTTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAGCAAATCGGAGACAACCTGATTGTCCCTGGAGGAGTGAAGACCATCGAGGCCAATGGGAAGATGGTGATTCCTGGCGGCATCGATGTCCACACTCACTTCCAGATGCCCTACAAGGGGATGACCACAGTGGATGACTTCTTCCAAGGGACAAAGGCCGCCTTAGCGGGTGGCACAACCATGATCATTGACCATGTGGTGCCCGAGCCGGAGTCCAGCCTGACGGAGGCCTATGAGAAGTGGCGAGAATGGGCCGATGGGAAGAGCTGCTGTGACTACGCCTTGCACGTGGACATCACCCACTGGAATGACAGTGTCAAGCAGGAGGTGCAGAGCCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTACATGGCCTATAAGGATTTGTATCAAGTGTCCAACACAGAGCTCTACGAGATCTTCACCTGTCTGGGAGAGCTGGGAGCCATTGCTCAAGTTCATGCTGAGAATGGGGACATCATCGCCCAGGAGCAAAGCCGGATGTTGGAAATAGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGACCAGAGGAGCTGGAAGCTGAGGCCGTGTTCCGTGCCATCACCATCGCCAGCCAAACCAACTGCCCTCTCTATGTCACGAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAACGTGGTCTTTGGCGAGCCCATCACTGCCAGCCTCGGCACAGATGGAACCCATTACTGGAGCAAGAACTGGGCCAAAGCAGCTGCCTTTGTGACATCCCCACCTCTGAGTCCTGACCCGACCACTCCTGACTACATCAACTCCTTGCTGGCCAGTGGGGACCTGCAGCTTTCTGGCAGTGCCCACTGCACCTTCAGCACCGCCCAGAAAGCAATCGGGAAGGACAATTTCACAGCCATTCCCGAGGGCACCAACGGGGTAGAGGAGCGGATGTCTGTCATTTGGGACAAGGCTGTGGCCACCGGGAAAATGGATGAAAACCAGTTCGTGGCCGTGACTAGCACGAATGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGTGACCTGGTGATCTGGGATCCAGATGCAGTAAAGATTGTGTCCGCCAAGAACCACCAGTCGGCTGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGTGGAGCCCCTCTGGTGGTCATCTGTCAGGGCAAGATCATGCTGGAAGATGGCGGCCTGCACGTGACCCAGGGGGCTGGCCGCTTCATCCCCTGCAGCCCCTTCTCCGACTATGTCTACAAGCGCATAAAAGCCAGGAGGAAGATGGCAGACCTGCACGCGGTCCCGAGGGGCATGTACGATGGGCCCGTGTTCGACCTGACCACCACGCCCAAGGCGGGCACCCCGGCGGGCTCCACGCGGGGCTCTCCCACGCGGCCGAACCCGCCCGTGAGGAACCTCCACCAGTCCGGATTCAGCCTGTCGGGAACCCAAGTGGACGAAGGGGTCCGCTCCGCCAGCAAGCGCATCGTGGCGCCCCCTGGAGGCCGTTCTAACATCACATCTCTGAGTTAAGCCACCCCTTCCCAAAGAGGGGCAGAAGCAGCAAGAGATTTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAAAACAGTTGCGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAAAATTGCTTTGTTTTCTGTCTGTGCCTAGCCTTGATTTGGTTGACTCCTCCCCCCCATTTGCATGCATGCAATCAGGCCACTAAGGTAAAAGAGTCTGCTATATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTAAGACAAGGGGACAGACAAAGCTGGATGTCAGGAAAATGAACAAAAGGGACACAGTTATTTGGGGTGAGTGGGTGGTGGGAGCCCAGAGCAAGATGGAGGGTTCAGCGGGGCTGGGGTAGGGTATGTAAG