Transcript asmbl_26087

Sequence
Transcript Sequence for observation asmbl_26087 of TGE0002143:
CCGCCTTCCACTCCGCCCCTGGCGGAGGAAGTGAGATCAGAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACGAGCATGATATCGCTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGACGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTCGGAGCCATCACATCTGTACAACAGAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTTTACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTTAACATTGACTTTGAACCTTTCAAACCAATTAATACATCATTGTATTTGTGCGACAATAAGTTTCATACAGAGGCTCTTACAGCGTTACTTTCAGATGACAGCAAGTTTGGTTTTATTGTAATAGACGGAAGTGGTGCTCTTTTTGGCACGCTCCAAGGAAACACCAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGCAGAGGAGGTCAATCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGAGACATAACTATGTTCGGAAAGTAGCCGAGACTGCTGTGCAGCTGTTTATTTCTGGAGACAAAGTGAATGTGGCTGGTTTGGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGACATGTTTGACCAGAGGTTGCAATCTAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAATTATCTACTGAAGTTCTCTCCAACGTGAAGTTCATTCAAGAGAAGAAATTAATAGGACGATATTTTGATGAAATTAGCCAGGACACAGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATACGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATTTAACTCCAGAACAAGAGAAGGATAAATCTCACTTCACAGACAAAGAGACTGGACAGGAACACGAACTGATAGAAAGCATGCCTCTCTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACACTAGAAATTGTCACAGATAAGTCACAAGAAGGATCACAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAGTACCAAGGAGGAGATGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAACCGTGCCTCACCCTCCAGCATTCAACCCAAGGAGCATACCCGTGGTGGAGTCCAACAGATCCCTGCCTTACAATTGGAGCATTTCCAGAACTTAATCCGTGAGCATTGGATACTGAAAAGAAAAGTGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCGTGGTGTCAGCGCAGCAGCCGACAACTAAGTCTCTAAAGGCCACTGTGGACTCATTTAAAAAGAATCCCAGTTTTTACTTTTACTTGATGGTAAAATTGGTTGCTCTTGTATTTTATGAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAGTAGACGTGAGGTCATACTGGTTTGTTTCTTCCTTTGATCGGAGAATAACTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCGGCTTAGACTGCACAAGAAGAAATATATGTGAAATATTGGAACTGTTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTGACAGGAGGCAGTTTGAGCTTCACTCCCTCACACTCCCCACTCCCAGACTGTCCCTTTCAAAGGTGCAGGTTGCGTTGTAAAGTCAGACTGAGTGCCAACACACTGGGGCCAGGGCACTCTGGGCAGTCACCAGTGTGGAGGCACAGTTGTGCCTGGCATTTGGGAGCCCTCTGTGCCATTAGCGTTACTGAGGCTCCCTGTCATCTCAGCCTACTAGAAACCAGTCTGGGATGGACATGATGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAACTTAAGTGGAACCAAAAAAAAATTCAAAGATGATTTTGCTTGGATCTATTCTTGGTAAGGGGAGGCGGTGGTGTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTATTTTTTTGTTTTCAAATGAACTGCAAGATTTTTTTCACGGGAACGACAGACACGACACGTATGACCGTGCATGTATCTCAAACCCCTGGTGGGGCTGGAGCATCTATTTCAAAAAGTGGGATCTACAAGCACCTCTCAGATGAGAAAGTATGGAGGCGGGTGGGGAGGGTAGGGGTGGGGTGGGTAGGACACGGCTGCTGGCACCATGGACTATATAAACCATGTTAGAGCCGGAAGTTGGCCTGAAAACCTGAGGCTTAGGCTTCATAGCTGGGCTGTAAATTGGATTTAAACCCAGTTGGAGTGCAAAGTCATGGTGTGCTCAAGGTGGTGACAGTGAACAGAGTATGGGGTGCCCGGTGGTAGCGGTGGGAAAACTATACCGAGTAGACTTTGAAGGACCGAAGGTTTTTTAAGTCAACTGGTATCACCCACACTCACCAGGGTGGTAGGGTGCATTGGGTTTCAAATTGGGTACTTTTAACACTTTAGTGCCTGACTGCTGTTCTTCACTGACTTGACTCAGTCACTTGTAGCTTTATTGGTCTGAACCAGCTCCTTGTTCCCAGGTTACAGACCTGCCTATCTATCGTTCCAATAATCCTGTTTCACTTGAATGAAGGGAGTCTGTCTTCAATGTAAAGCTTCTGCTTCTCACACTGTACCCTGAGGTCCAAATGACTGTCTGTCCTGTAACCTGATGTCTCAACCCAGTGAGAAGAGTCAGTTCCTTAGTGTTCACCAACACGGGAGGCTTCACCGGAACAGGCTTTTGCTTTGGGCTCTGCTGTTTGTTTGCAGAACACCCAAGAGCGAGCGAACACACCCTTCCCAGCAGTACCTTAGGGTTTTGCCATTGTAAATGGGTCTAATGTGATATGACAAGACCAGAGAAATTGGATGTAAATTTACATTTTTGAATATGCTTGTTGTTTCACATGATACATTTAGGGTATGCAGCTCCTTTTGTAGTTTTTATTTTTACTATTTAAGTTTGGAAATGATGCCAAATTTTTGTATTTCTTTAATCAATGTGTTCTCCTTGGTGATATATATTGCATTATATATTGATGTGTGTATCAATATATACCGATATGTGTTACACTTACGCATACAAACACACATAAGTGAGGGGTGAAACCGTAGCCTGCACTCCCTAGCCTCTGCAGAGAGACCCTAAGAGCAGAATCTCGGTGTTGTGATGTACAGAAATGGAGAAGAGTATTAAACCATATTTAAGAATATA