Transcript asmbl_25862

Sequence
Transcript Sequence for observation asmbl_25862 of TGE0002158:
GCCCGAGCTCCCTTTCCCAGAGTGCTCCGCGCCGTGAAGAAGCGGCTCCCGGGGACTGGGGGCATTTTGTGTTGGCTGGAGCTAGAGTAACAAGATGGCGGCCTCGGCGGAGTGACGGCTTCCCTCCGGGCCGGAGCCGGCGGCAGTGGTGGCAGCGGTACCGCCCGCCCTCGTTCACCGCGCCCCTTTCCCAGCCCGCGACGTCGCCGCGACCACGAAAAAAAATCAGCGGCGGCCGCCCGAGAACAACAAGCGGCCGAGCTTCAGCAGCCGCGACCACCCTTCACGAACCGCGGCCTGGCCCTTCAGCGAGCGGCGGCGGCGGCGATCCGGCTTCTCTCTGCCGCCTGTGCGCCCCGTGACGCCGACAGAGCCTTGGGTTTAGGTTGCCCGCCGCGCTTCTCACTTCTGCCGCGGGTGGAACAGCCCCGGAGGCTTCCATCCTCTTCCTGAGGTGTCGGGGCTCGGCCCCCCGCCTCCATCTTCGCGTCTCAGGATGGCGAGCAGCAGCGGCTCCAAGGCCGAATTTATCGTCGGTGGAAAATACAAACTGGTGCGGAAGATCGGATCTGGCTCTTTCGGGGACATTTATCTAGCGATCAACATCACCAATGGCGAGGAAGTGGCAGTGAAACTAGAATCCCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAGAGCAAACTGTATAAGATTCTTCAAGGTGGGGTTGGCATCCCTCACATACGGTGGTATGGGCAAGAAAAAGACTATAATGTACTAGTCATGGATCTCCTGGGACCCAGCCTTGAAGACCTCTTCAACTTCTGTTCAAGGAGGTTCACTATGAAGACCGTACTTATGTTAGCTGACCAGATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCAATGCACATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCTTTAGGATATGTTTTGATGTATTTTAATAGAACCAGTCTGCCGTGGCAAGGACTGAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAGGTGTTGTGTAAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAATTACTGTCGTGGGCTGCGCTTTGAGGAAGCTCCGGATTACATGTATCTGAGGCAGCTATTCCGCATCCTTTTCAGGACCCTGAACCACCAATATGACTACACATTTGATTGGACGATGTTAAAGCAGAAAGCAGCCCAGCAGGCAGCCTCTTCCAGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGTAACATGAAAGGTTTCTAAGCATGAATTGTGGAAGAGAAGCAGCAGAGCAGACGATTGGAGCAGCGTTTGTTTCTCCCCAAACCTAGACATTTTAGTTCATATGTACACTAGCCAGTGGTTGTGGACAACCATTTACTTGGTGTAAAGAACTTCATTTCGGTATAAACTGGCTCTGGGTAGCACTGCGGATCCTGAGCTGTAGCCACTGTCCTTGTGAATATTAACTGAGGTAGTGAAACATGGTGTCCGGTTTTCTATTGCATTTTTTTTCAAGTGGAAAAGTTAACTAAATGGTTGACACACAAATTGGTGGAGAAATTGTGCATATGCCAATTTTTATTTTATTTTTTTGTTAAAATCTTTTATTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTAAATGTTCACAATTGTGTGTTCTTAGGGTTTTCCATCCCTGGGGTTTGCAAGTTGTTAACTTAAAACATTCTTTAAATGGCTGGCTTCTTGTTTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATTTGAAAGACTCTGCCTGCTTACCTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAAAAACATAGCGACTACTAGATTCTCTTTAGGACTCTGCATTAACTCTATAATGTTCTTGCTATTAAAAAAAAGCATATTTGTCACGGAAATTTAGTTACCGTCTTACAACTGAACATGTATGTGTGTTGCTTAGATAAATGTAATCACTGTAAACATCTATACGATCTGGGATTTTGTTTTTATTTTGAAATGGGAGCTTTTTGTTTACAAGTTCATTAAAAACTAAAAACTGTTTCTGTAAGGAAGTGAAATTTTTTTAAACAACAAAATGCCTTGGCTGACTCACTATGAAGTGTGTGTGTGTGTGTGTGTACAT