Transcript asmbl_22748

Sequence
Transcript Sequence for observation asmbl_22748 of TGE0047845:
GGGAAGACCGGTAGGGTCGCCGTGACCTCGGCGGTGCTCCTGACTACTGTTCCCTCTCCCCGCGCAGCCCAGGTGGGGAAGACGTCTCTGATCCTGTCGCTGGTCGGCGAGGAGTTTCCCGAGGAGGTCCCTGCCCGCGCGGAGGAGATAACCATCCCCGCCGACGTCACCCCGGAGAAGGTGCCCACTCATATCGTGGATTACTCAGAAGCGGAGCAGACAGAGGAAGAACTTCAGGAGGAGATCCACAAGGCAAATGTAGTGTGTGTGGTGTACGATGTGTCTGAGGAGACCACCATTGAGAAGATCCGAACCAAGTGGATCCCGCTTGTGAATGGCAGGACGGCGACAGGGCCCAGGTTGCCCATCATCCTGGTGGGCAATAAGTCTGACCTGCGGCCGGGGAGTACCATGGAGGCTGTGCTGCCCATCATGAGCCAGTTTCCTGAGATAGAGACCTGCGTGGAGTGTTCAGCCAAGCACTTGAGGAATATCTCAGAGCTGTTCTACTATGCCCAGAAGGCTGTTCTGCATCCCACAGCCCCCCTTTATGACCCTGAGGCCAAACAGCTCAGGCCTGCATGCGCCCAGGCGCTCACACGCATCTTCAGGCTGTCGGACCAGGACCGAGACCACGGGCTGAGCGACGAGGAACTCAATGCCTTCCAGAAGTCCTGCTTTGGCCATCCCCTGGCCCCACAGGCCCTGGAGGATGTGAAGAGGGTGGTGTGCAAGAACGTGTCAGGTGGTGTGCAGAATGACCGGCTGACCCTGGAAGGCTTCCTCTTCCTGAACACACTCTTCATCCAGCGTGGCCGGCACGAGACCACGTGGACCATCCTGCGGCGCTTTGGTTACAGTGACTCACTGGAGCTAACGCCCGACTACCTCTATCCAGCGCTCCATGTCCCCCCTGGCTGCAGCACAGAGCTCAACCATCGTGGCTACCAGTTTGTGCAGCGGATGTTCGAGAAGCATGACCAGGTAAGCACGTCACCTCACGCCTTGACACCCCTCCCCGCAAAGAAACTTGTCACCATAGCCCCTTTGCCTGTAGGACCATGATGGTGTCCTCTCGCCCACGGAACTACAGAATCTCTTCAGTGTGTTCTCAGGTGCTCCATGGGGCCCTGAACTCTTACACACAGTCCCCACTCAGGCTGGCTGTCTGCCTTTGCATGGCTATCTCTGCCAGTGGACCCTCATGACCTACTTGGATGTCCAGCAATGCCTTGCACACCTTGGCTACCTGGGTTACCCTACCCTCTGTGAACAGGACTCTCAGGCACAGGCTATCACAGTTACCCGCGAGAAGAAGCTGGACCAGGAGAAAGGGCAGACACAGCGCAGCGTTCTCATGTGTAAGGTGCTGGGAGCCCGAGGAGTGGGCAAGTCAGCCTTCTTGCAAGCCTTCCTTGGCAACAGCCTTGGGGAAGCCAGGGACCCCCCTGAGAAATTCCCCCTGCATACCATCAATACAGTGCGGGTCAACGGGCAGGAGAAGTACCTGATTCTGTGTGAAGTGAATGCTGACAGCCTGCTGGACACCTCTCTAGACACTACCTGTGATGTCGCCTGCTTAATGTTTGACAGCAGTGATCCCAAGACCTTTGTACACTGTGCTACCATATACAAGCGTTATTACATGGATGGGCAGACCCCCTGCCTCTTTATTGCCTCCAAAGCTGATCTCCCTGAAGGTGTTGCCCCCCCAGGGCTGTCACCCGCTGAGTTCTGCCGGAGGCACCGGCTGCCTGCCCCAGCTTCATTCTCCTGCTTGGGACCCGCAATGCCCAGC