Transcript asmbl_22566

Sequence
Transcript Sequence for observation asmbl_22566 of TGE0047821:
CTTCCCTCCGCCTGCAGGTCCCGACGCGTCTCCGCCGTCGCCGTCGCCGTCGCCTCCGCCGTACAGCCGAATAGCCGAGGACCCACGCAGAGCCACCAACCAGCCAAGATGCCCAAGCCAATCAACGTCCGGGTGACCACCATGGATGCCGAGCTGGAGTTTGCCATCCAGCCAAACACCACCGGGAAGCAGCTCTTTGATCAGGTGGTAAAGACGATTGGCCTCCGGGAAGTGTGGTACTTCGGCCTCCAGTATGTAGACAATAAAGGATTTCCTACCTGGCTGAAACTTGATAAAAAGGTCTCCGCACAGGAGGTCCGAAAGGAGAACCCTGTCCAGTTTAAATTCCGGGCCAAGTTCTACCCCGAAGACGTGGCCGAGGAACTCATCCAGGACATCACACAGAAGCTCTTCTTCCTGCAAGTCAAGGACGGGATCCTCAGCGACGAGATCTACTGCCCCCCAGAGACAGCCGTGCTCCTGGGCTCCTATGCCGTTCAGGCCAAGTTCGGAGATTATAACAAGGAAATGCACAAGTCTGGGTACCTCAGCTCGGAGCGGCTGATCCCCCAGAGAGTCATGGACCAACACAAGCTCAGCAGGGACCAGTGGGAGGACCGGATCCAGGTGTGGCACGCGGAACACCGAGGGATGCTCAAGGACAGTGCTATGCTAGAATACCTGAAGATTGCCCAGGACCTGGAAATGTATGGGATCAACTATTTCGAGATCAAAAACAAGAAAGGAACAGACCTTTGGCTTGGAGTCGATGCCCTTGGACTTAACATTTATGAGAAAGATGACAAGTTGACCCCAAAGATCGGCTTCCCTTGGAGTGAGATCAGGAACATCTCTTTCAACGACAAGAAGTTTGTCATTAAGCCCATCGACAAGAAGGCACCTGACTTTGTGTTCTACGCCCCGCGCCTGAGAATTAACAAGCGGATCCTGCAGCTCTGCATGGGGAACCATGAGCTGTACATGCGCCGCAGGAAGCCCGACACCATCGAGGTGCAGCAGATGAAGGCCCAG