Transcript asmbl_22389

Sequence
Transcript Sequence for observation asmbl_22389 of TGE0032516:
CGGAGCTCTAGCGGGTGCGAGCTTCCCTCCTCCTCACACCGGCGCTGGCTTATGGGATGCGCAGGCGCAGAACTCTCCCAGCAGAAAGCCCTCGGAGCCCGGGGGCCGGGCGCGGGGCCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCGTCGCACCGTCTGTCTTTGTGTTTCAAAAGGACAAAGGACAGAAGAGATCTGCTGGCAGCTCCAGTCCCGAAGCCGGAGAAGATTCTGACCATGAGGATGGAAACTACTGCCCCCCTGTCAAGCGTGAGCGGACATCCTCTCTAACTCACTCAGAAGAGAAGAGCAGCGGCTTCCGGCTGAAGCCCCCAACACTCATCCACGGTCAGGCACCCAGTGCAGGTCTGCCCAGCCAGAAACCCAGGGAACAGCAGCGTGGTGTGCTCCGTCCAGCTGTGCTGCAGGCCCCTCAGCCCAAGGTGCTGTCGCAGACGGTTCCCAGCAGTGGCACCAATGGAGTCAGTATGCCAGCAGACTGCACGGGGCCAGCAACGTCTGTATCACCAGAAAACCTCACGCAGAGGAGTCCCTCTGAGTCTGCCGAGGAGACACACACACTCGAGGAGAAGGTGCCTCAGAAAACCCCACATGGCACCTCAGAGGAGGGGCACTGTGAAGAGGAGCAGGCGGCCCCACAGGCCTTTGTGTTTGGACAGAACTTGAGAGACAGAGTGAAGTTAATGAATGAGAATGCCAGCGTGGCAGATGTAGACAGTGCTGCACATCCCAGCTCAGAAACACCCTCTGCGACCAACTACTTCCTTCAGTACATCAGTTCCAGCGCAGACAACGCGACCCACAGTGCTGACAACTCCACCAAGTTTGTGTTTGGCCAGAACATGAGTGAGCGCGTCTTGAGCCCCCCAAAGCTGAATGAAGCCAATTCAGACACCAGCAGGGAGACTACACATGCCCAGTCAGGTTCTGAGTCGTCATCCCAGGAGGCCGCCCCCAAGAAAGAGTCCCTGGCAGAGTCAGCCGCTGCCTATACAAAGGCTACAGCGTGGACGTGTTTGCTGGAGAAGGTGGAGGTCATCACGGGGGAGGAGGCAGAGAGCAATGTGCTGCAGATCCAGTGTAAGCTGTTTGTGTTCGATAAGACCTCACAGTCATGGGTGGAGCGTGGCCGGGGACTTCTCAGGCTCAATGACATGGCGTCAACCGACGATGGCACATTACAGTCCCGGCTAGTGATGCGGACCCAGGGCAGCCTGCGGCTCATCCTGAACACGAAGCTGTGGGCACAGATGCAGATGGATAAGGCCAGTGAAAAGAGCATCCGCATCACAGCCACCGACGCTGAGGACCAGGGTGTCAAGGTTTTCCTGATCTCGGCCAGCTCCAAAGACACAGGCCAACTGTATGCTGCACTGCACCACCGCATCCTGGCTCTGCGTAGCCGGGCTGAACAGGAACAGGAGGCCAAGGCGCCCCCACCTGAGCCAGGAGCCACCCGGGCCACCGAGGAGGAAGACAGTGATGAGGATGCTGTTCTGGCTCCCTCCGGTGTCACGGGGGCTGGCACAGGTGATGAAGGAGATGGCCAGGCTCCTGGGAGCACATAGCGGCGGAGCCACTGCACCAGGCTGCTGCTTTGTTGTCTGTCTGCTGCCCGTCCCTCCCTGCAGGCCGCATCATGGTGGTGTCTATTGCCGGGGTGGCCACAGGCTGGATCCGAGTGTCCCCTCTGCAGCAGACGGGGACGCCAGGATGCGGCTTGGGACTCAGACCTCATCATATTGATGAGTAGAAAGAACGTTCCCCCGCCCTCCTCCGATCGAAATGGCACATTGACACTTGTCACAGCTTCGTGGTGACCGTCCATCCCTGGGCAGCAACAAAGAGAACTCCAGGCTCAGCATTCTGTTGAGTAACTTGCTACCTGCTCGGCTTTCCACTCTGCCAGGTCCACATGGCAGGTGCCTCTCCTTCATTTCTGGTGGCTTGGCTCTTGAGGTCACAGATGAAGCTACACGTGGGCTGAGCTGACTTGATGCTCCTATGGGTGGTGCCCGGCCCCCACGGGGGTTCACTAGGTTTGGGCCTGAGAACACCTGTCTGGACAAAGGTGATGAAACCAAGAGAGCTCCTGCCTTCTTGCCTGCCTACGTGAACCACCTGGGTCTCCCTTAGCAGGTACCCAGCCCTGAGGTGACTGACCACCTAGGGCCCCTGAGAGGCAAAGGGAACCTGCAAAGGGCCTGTCCCCGGGCAGAAGATGAAGCCCCTACCCGTGGACTGTGTGGTTCCATCTCTGGCCAGGCCACTTCCAGCCAGCAAGGACACCAGAGGCTGCCTTAGCAGATGGGTCACACTGCTTCCAGCCTTAGCCAGCCAGTGACAAGTGAATCCAGACGTCACCCATGTGTTTTGGAACATTTATGTAAGATTGAAATGTATTTGAGAACTGCATTAAAACTTTTAACTAAA