Transcript asmbl_22018

Sequence
Transcript Sequence for observation asmbl_22018 of TGE0003604:
GCAGCCGCAGCCATGAGGTAAGTTGTTATCGTGGCGCTATCCGCCGCCATCCGTGCACCCACACGCCCGCGGACGCCCCGCGGCCCGTCTCGGAGGCTCTCCCGGCGACTGCCCCGCGTCGCGAGCCTTTCCCCAGCGTGCCGTGGGCCTGTCATCGGGCCCGGGGTGCAGCATGGCCGGCCCCGAACGCCTTCGCTTCTCCCCAACAGCAGCAAAGTCTCACGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTTCTGGAGACGGTGGAGCTGCAGATCAGCCTGAAGAACTACGACCCTCAGAAGGACAAACGTTTCTCGGGCACCGTCAGGTTGGCACCGCTCTAACCCCACCCAGCCCTCAGTGTTCCCGTGTGGCCTGGCCGCGCCCTAGGCGGGCACGGGGACACTGACGTGCCAGGGTAGTTCAGGAGCCCTGCTGCAGGCAGGCAGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTCGGCCGAGCCCGCCGCCTAGCCTGAGAAGCCAGGCTAGTGTTGCCCAGAGCTCCGGGCTCAAGTCCACCCCACGCCCCAAGTTCTCGGTGTGCGTTCTGGGGGACCAGCAGCACTGTGATGAAGCCAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTCAAGAAGCTTAACAAAAACAAGAAGTTGGTCAAGAAGCTGGCTAAGAAGTACGATGCCTTTTTGGCCTCTGAGTCTCTGATTAAGCAGATCCCACGTATCCTGGGCCCAGGCCTAAACAAGGCTGGCAAGTTCCCCTCCCTGCTGACACACAATGAAAACATGGTGGCCAAAGTGGATGAGGTGAAATCGACAATCAAGTTCCAGATGAAGAAGGTGCTGTGTTTGGCCGTCGCTGTTGGCCACGTGAAGATGACCGATGATGAGCTAGTCTACAACATTCATCTGGCTGTCAATTTCTTGGTGTCCTTGCTTAAGAAAAACTGGCAAAACGTGCGGGCTCTGTACATCAAGAGCACCATGGGCAAGCCCCAGCGTCTGTATTAGGATGCTCCAATAAACCTCACTGCTGCCACTCA