Transcript asmbl_22016

Sequence
Transcript Sequence for observation asmbl_22016 of TGE0003604:
GCAGCCGCAGCCATGAGGTAAGTTGTTATCGTGGCGCTATCCGCCGCCATCCGTGCACCCACACGCCCGCGGACGCCCCGCGGCCCGTCTCGGAGGCTCTCCCGGCGACTGCCCCGCGTCGCGAGCCTTTCCCCAGCGTGCCGTGGGCCTGTCATCGGGCCCGGGGTGCAGCATGGCCGGCCCCGAACGCCTTCGCTTCTCCCCAACAGCAGCAAAGTCTCACGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTTCTGGAGACGGTGGAGCTGCAGATCAGCCTGAAGAACTACGACCCTCAGAAGGACAAACGTTTCTCGGGCACCGTCAGGCTCAAGTCCACCCCACGCCCCAAGTTCTCGGTGTGCGTTCTGGGGGACCAGCAGCACTGTGATGAAGCCAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTCAAGAAGCTTAACAAAAACAAGAAGTTGGTCAAGAAGCTGGCTAAGAAGTACGATGCCTTTTTGGCCTCTGAGTCTCTGATTAAGCAGATCCCACGTATCCTGGGCCCAGGCCTAAACAAGGCTGGCAAGTTCCCCTCCCTGCTGACACACAATGAAAACATGGTGGCCAAAGTGGATGAGGTGAAATCGACAATCAAGTTCCAGATGAAGAAGGTGCTGTGTTTGGCCGTCGCTGTTGGCCACGTGAAGATGACCGATGATGAGCTAGTCTACAACATTCATCTGGCTGTCAATTTCTTGGTGTCCTTGCTTAAGAAAAACTGGCAAAACGTGCGGGCTCTGTACATCAAGAGCACCATGGGCAAGCCCCAGCGTCTGTATTAGGATGCTCCAATAAACCTCACTGCTGCCACTCA