Transcript asmbl_20508

Sequence
Transcript Sequence for observation asmbl_20508 of TGE0007602:
GGGCGCTGAGTGGGTTTTCGGATCATGTCTGGTGGCTCCGCGGATTACAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCATATGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATCCCTTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTT