Transcript asmbl_20502

Sequence
Transcript Sequence for observation asmbl_20502 of TGE0031446:
CTTTGAAGTAATACTTCCTGATGAAGCTGCAAGCTTTATTCGGGTCAAGATTATAAGGCTCAGTGCCTTGTGGGAAAAAATACCAATATTTGCCCTTAAAAGCATTTCACTACACAGTGGAGAATGTAGAAATTGATTATTTACGTTCCTAGTTGGTGTTTGAGGTAACAAGGTCCCAAGTTTAAAAAGAGGAGGGAGCATTAAGTTTAAGGTGAATTTTAAGCTTGAAATTAGTAAATTTTGTGCTATGCATGCATAAAAGCTGTTGGCATATATAATAGTGCAATTATGCCTTTAAGCTTAGTCTTAGACCTAGGTTTTATAGAATAACTACCATTTTTGGCTTTTAGATCCAAAAGGTAATTTTGGCTCTTGGAGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGCTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAAACAATTTTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTTTGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAAAGAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGCCCGTGGGATTGACGTGCAACAAGTGTCCTTGGTTATAAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGAGTCGATAGCGGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGATTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCCAAGGCATTTTGTATGTTAGCATTTCTGATAGGGAGTGATAGGTGGTTTGTATTGTCTGGTACTTTGTAGGAAGGTAGAGAGCTGTTTTGGAGGTAACACGTTTGAGTAATTTGAGTATATAACGTGTGAAAAGAAGCTGAGCAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATACTTGCTTTCACACTGGAAAAAAAGTAAGTTTTAGAAAATAGTTAACCTTGCAGCATTTGTATTTACAGTTCCAGAAGTGCGTCGAAATGGATTGTATAACTGTTTTCTTTTATTCCTGGTGTTTACATTTGTCCCAGGCTGACAACTGCTCCTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACCCCAAACACAATACTGTCATCTGCTTTATTGTAATGCTCAAGGCGCCTATCTCATTTTGCAGCCAGACAAGCCTTGAATTCTTTTGGTGGCACTATCTGCAAAGGAAGATGTTTTTCCACCTGGATATTGGTTTTATCAGCTAGTGCTCCACTTAAAAGCACGAACTATAATCCTGATAAGTAAACAGCAGCTGATGGTTAACAAGTGGATCGTCATATTCAGTAGCTTTAAATAGTACTAAAGTAACTTGCTGACTGTTGGTTTCTTTCTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAATCCCTGGGATGAGATAGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCCTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAAATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTGGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAGAGGCCTTTAAAGTGATTTCTTTTTTTTAGAGAAAATTTGAATGCATTTTGTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCATCCTAGGTAGGGTTAAACCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAAATTGTATATTCACTTT