Transcript asmbl_20481

Sequence
Transcript Sequence for observation asmbl_20481 of TGE0007598:
GGCGGAAGTGAAGAAGCCCCGAGAAGGAGGCAGCGGAAGTGGCTGCGTGACTGCAGCCCGTGCGCACGCGCCCTCGGCCTCGTTGCCGCTTTTGGGGCGGTACTCTGCCCTGTCTTACTTTTCTCCACGTGAGGGGGTGCGCGAATCCCCAGTGGTGGCCGCGCGCTCACATCCTCTGCAGCTTTCGTGCCCTTCGCGATGGCGGGCATCCTGTTCGAGGATATTTTCGATGTGAAAGACATCGACCCAGAAGGCAAGAAATTTGACCGAGTATCCCGGCTGCACTGTGAGAGTGAATCTTTCAAGATGGACCTCATCTTAGATGTAAACATTCAGATTTACCCTGTGGACTTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACAACCCCACAGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGATGAGACCTCCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGCCAACAACCTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAACCAGACTTGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGGGGCGGAACTCTGTCCACTGTGGGGACGTCTTCAGTTTGTCTGAATGCAGTGGAAAACCGACTCTCCCTCTCGGAAGGCCGAGAGGGAGAACTTAGCATGAAC