Transcript asmbl_197

Sequence
Transcript Sequence for observation asmbl_197 of TGE0032174:
CTTAAAATTTGGCTCAAGCTAGTTATTTTCTTTATTTTCCTAATAGATTACGAATCTAGATAGATAAGAAACAAAAGTCTTAAGGGGACTGGATGCTTTTAGGACTACGCTTGACTAATCGATGTTTCCTAAATCTCGGAATAGGTACTTGATGTGTGCGGGCTGGGCGCTGGTGGAAATCGAACCTCGTGGTATGTTCTGTAGGAACCTGAGGGAGCTAACTGAAGCCTAGCTCCTGCTGCGCTTGCGGCGCAGTCTACCTTAGAGCTGCTTGATTATCAACGCACACATTTTCGTGGAGAAGTCTCGTGTGTATATTCAGCCATGGCACAACTCCAGGCACGTTTCTACAGCGAGAACAAGAAATACGCAGTGGATGATGTCCCTTTCTCAATCCCTGCCGCTGCTGAAGTTGCGGACCTTAGTAACATTATCAATAAGTTGCTGGAGACCAAAAATGAACTCCACAAGCATGTCGAGTTTGATTTCCTTATCAAGGGCCAGTTTCTTCGAGTGCCCTTGGTCAAACACATGGAACTGGAGAACATTTCATCGGAAGAGGTTGTGGAACTAGAATATGTGGAAAAGTACACCGCACCCCAGCCAGAGCAGTGCATGTTCCATGATGACTGGATCAGCTCAATTGAAGGGGCAGAAGAATGGATCCTGTCTGGTTCTTATGATAAGACTTCTCGGATCTGGTCCTTGGAAGGAAAGTCGATAATGACAATTGTGGGACATACAGATGTTGTGAAAGATGTGGCTTGGGTGAAAAAAGACAGTTTGTCCTGCTTACTACTGACGGCCTCGATGGACCAGACTGTTCTCTTATGGGAGTGGAATGTAGAGAAGAACAAAGTGAAAGCTCTGCACTGCTGCCGAGGGCATGCTGGGAGTGTGGACGCCATCGCAGTCGATAGCTCGGGAGCTAAGTTTTGCAGTGGCTCCTGGGATAAGATGCTAAAGATCTGGTCTACAGTCCCTACAGATGAAGAAGATGAAATGGAAGAAGCCACAAATCGACCAAGAAAAAAGCAAAAAACAGAACAATTGGGACTAACAAGAACACCCTTGGTGACCCTCTCTGGCCACACAGAAGCAATTTCCTCAGTCCTTTGGTCAGACGCTGAAGAAATCTGTAGTGCATCTTGGGATCACACAATTAGAGTGTGGGATGTTGAGTCTGGCGGTCTTAAGTCAACTCTGACAGGAAATAAAGTGTTTAATTGTATTTCCTATTCTCCCCTTTGTAAACGTTTGGCATCTGGAAGCACAGACAGGCATATTAGACTGTGGGATCCCCGAACTAAAGATGGTTCTTTGGTGTCGCTGTCTCTCACCTCACACACAGGCTGGGTGACATCAGTGAAGTGGTCTCCTACCCATGAACAGCAGCTCATCTCGGGCTCTTTAGATAACATTGTGAAGCTATGGGATACAAGAAGCTGTAAGGCTCCTCTCTACGATCTAGCTGCTCATGAAGACAAAGTTCTAAGTGTGGACTGGACAGACACAGGGCTACTTCTGAGTGGAGGAGCAGACAATAAATTGTATTCCTACAGCTATTCCCCTACCACTTCCCATGTGGGGGCTTGAAAATGAATGGCTGAGAAGAGACTTCCTTGTTGGGTCTTGTCTTAATTCTTAGTGTCTCACTGTTATTTCATAAACTGAATCAAATTTGAGAGAGGACTTATAGTACAGCTCAGCTGGTAGAATGCTTGCCTAAAATGTGCACAGCCCTGCATGCTATCTCCAGCACTGCCCAAAGAAAAATGGGCATGGTAGCACATTCCTGTAATCCCAGTCCTAGAGGTTGGAAGCAAGAGCATCAGAAATTCAAGGTCACCCTCTGCTGTATAGTGAGCTTAAAGGCAGCCAGCCATGGTTCCCTGAGTCTCTGTCTCCATAAGAAAGAAATCAATGGATAATCCTCTGATATCATTGTCAATGCAGAGACAGGAAGCAGCCTTTTAAAATTTGGATAACAGTTCATCTTTCATAATAGCAACATTTTACTGTCTTTGTCCTTCGTGCTTATAAAATACAGTAAGTATGTGGTCTGAATTCTGTC