Transcript asmbl_19278

Sequence
Transcript Sequence for observation asmbl_19278 of TGE0032292:
ATCGCGGCCGGAGCCGCCATTGTTCCGCCGGGGGAGGACAGCGGGTCCTGGCGCTGGCGCCCCGACGCCGCTTAGCGGCCGCCTCTGGAGACACTCTGTCCCCGCCGCCCCGTGTCCTCCTGGTGGCGGCGGCGTGAGGCCGGCTGCGGAGACTGGGAACCTTTGGCTCTCCCCGTGGCGGCGGCGGCCCTCTATCCCCTACTCCGGCGTGAGGGTTGGCCGCGATGCGCTCGGCCTGAGGTGTCGCGGCCCTGTCGCCTCCCACGACTGTTCCAGCGGCGGCTCCGCTCCCCGGCGTCATCCCGCGAGTCTCTCTGACGGGAGGGAAGATGGCTGCACGAAGCTGGCAGGACGAGCTGGCCCAGCAGGCCGAGGAGGGCTCTGCCCGGCTGCGGGAGTTGCTCTCGGTCGGCCTAGGTTTTCTGCGCACGGAGTTGGGCCTCGACCTGGGGCTAGAGCCGAAGCGGTACCCGGGCTGGGTGATCCTGGTGGGCACCGGCGCTCTCGGGCTGCTCCTGCTCTTCCTTCTAGGTTACGGCTGGGCCGCGGCTTGCGCCGGCGCCCGCAAGAAGCGAAGGAGCCCGCCCCGCAAACGGGAGGAGGCGGCCCCGCCGACTCCGGCCCCCGACGACCTAGCCCAGCTGAAGAATCTCAGAAGCGAGGAGCAAAAGAAGAAGAACCGGAAGAAGCTTCCTGAAAAGCCCAAACCAAATGGACGGACTGTTGAAGTACCCGAGGATGAAGTTGTTAGAAATCCCCGAAGTATAACTGCAAAACAAGCACCAGAGACAGACAAGAAAAATGAAAAGTCAAAGAAAAATAAGAAGAAATCAAAGTCAGATGCTAAAGCAGTGCAAAACAGTTCACGCCATGATGGAAAGGAAGTTGATGAAGGAGCCTGGGAAACTAAAATTAGTCACAGAGAGAAACGACAACAGCGTAAACGTGATAAAGTGCTGACTGATTCTGGTTCATTGGATTCAACTATCCCTGGGATAGAAAATATCATCACAGTTACCACCGAGCAACTTACAACTGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAGTCTGGAAAAGGAGATTCTACACTGCAGGTTTCTTCAAGGCTGAATGAAAATCTTACTGTCAATGGAGGAGGCTGGAGTGAAAAGTCTGTAAAACTCTCCTCACAATTGAGTGAGGAGAAGTGGAACTCTGTCCCACCTGCTTCTGCAGGCAAGAGGAAAACAGAGCCATCGGCTTGGACTCAAGACACTGGTGACACTAATGCAAATGGGAAAGACTGGGGAAGGAATTGGAGTGATCGCTCAATATTTTCTGGCATTGGATCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCTTATATCGATGATGAATGGTCTGGGTTAAATGGTTTGTCTTCTGCTGACCCTAGCTCAGACTGGAATGCACCAGCAGAGGAGTGGGGGAACTGGGTAGATGAAGATAGAGCTTCACTTCTGAAGTCCCAGGAACCAATTTCTAATGATCAAAAGGTTTCAGATGATGATAAAGAAAAAGGGGAGGGAGCTCTTCCAACTGGAAAATCTAAAAAGAAAAAGAAGAAAAAGAAGAAGCAAGGGGAAGATAACTCTCACACACAGGACACAGAAGACCTAGAAAAGGACACTAGAGAAGAGCTTCCAGTGAATACCTCAAAAGCCCGACCAAAACAGGAGAAAGCTTGTTCCCTGAAGACCATGAGCACTAGTGACCCAGCTGAAGTACTCATCAAAAATAGCCAGCCTGTCAAGACTCTTCCTCCTGCTATCTCTGCCGAGCCATCTATTACCTTATCAAAAGGTGACTCTGACAACAGCTCTTCCCAAGTGCCACCGATGTTACAAGACACAGACAAGCCCAAGTCAAATGCTAAGCAAAACAGTGTGCCTCCCTCACAGACCAAGTCTGAAACTAACTGGGAATCTCCAAAACAAATAAAAAAGAAGAAAAAGGCCAGACGGGAAACGTGAATTTTTTTTTCCTGAATTGGACATGTGTTTACAAACACTGTCTTGAAGATTATGCTGTTTATGCAATAATTTGTGAACATGTACAGAGTTTTATATAAATTTAAACCAATTTTTAAAACAAAACTGAACACAACCACCATAAAATGGAATCAAAGGAAAGTTAATTTATGAAATAAAGAGGTCAACAGAATACACAGTGCTGGAAGACACTTGGGAGAGTCTTTTCAATTGAACGAGAATGATCGTAATTTAAGACTATTATCCTGGTTTTACAACAGTTACCTGTTTACAACAGACTGTGCCCTGTCTCCTCTGCAGCTGAGGAATAATGAATGGATTCTGATTAGAGAGAAGGCTGCCGTGAGGCCAGTAGGCAAGTCCTTGGATCTTATGCACGACCTTAGACCATTTGAATCTGTTTTATGCTTAAATCAAAGTGCTTTGATCAAATGTATAATCTGCCATATCTTTACATATTTGTTGTAGCAGTTTGTATTAAAAGAATCACAAGTGCAAATTAAAAGGTCATTTATCATTTATTTAACTAAACTGTCTTGGTTTAGTTTACAGTTCTTTAAAAGTTCTAAATTAAAACATTAAAAAATGCAATTGACAGACACTTGTATGACTTACAAAGTTATTTTTGATAGTCTTAACATTACTTGAATTATTCAAAATAACAGTATATTTTAAATTAAGAAAGGTAAATATATTATTTGTTTGATACATTAAGACTGAGACTAACAATGCTCTTGTTTATGATTTGAAAAGTTTTCAGGCAAATCCAACTTAGTGTTTTTCCTTTCCCTAGCAATTTTCCAGTGTCAACTCTTAGTTGCTAGTAATTTTTTTACCTTAAAAATGAAGTAATTCGCAACTTTTGAGCATATGACGGAGAATGCAAAAGTAGTCAGACAGCTTTAATTGATATTGTGGAGACCTCCGGTTATCAGGAATACATTTTTTTACTGCCTTAACCTCCTGTAGTGAGTAGAATATGCATCAGTTTCTTGAAGGGGATTCGTGTTTTTATAAGAATTTTCATGTAACTATTGCAATTGTGGTTAAAAACAGAAAGGAACATTTTCTGCTTGAAACTGTGTTGATTTGAATGACGTATGATCTGTCACCATTTTCAGGCACTGTGTGATCCCTAGGAAAGTGGCAGGCCTCTCTGTAACTGTTAATAGTGCATGCTCGGCCATGTACACTGTAAATAGCCTTTACCAAACGTGTTTGACAAGGACCATAATTAACATCACTTTAGTAAATTGTGATTTTTTTAAAAAAAGCCATGATTTATTGATGTGAGTGGCTTGTTTTCATGTGGCGCCAGAAATGAACCTGTTTAAAAGCTATAACCAATGGTACTGATCTATCCATTAAATACTGTCCTTAAACTGTAGTTTAATAGTATTGTCAACTAGGAAAGCTAAAATGGTTTTTGTTCTGTTGAAGACTGGCCTTATTAATGGACAGCTTTCCTCAGAAGTGATTAACAACTTTTTTATTGGGTGTTAACATCTGTTTCAAGAACATGGCAGTATGTTTACATGTCGTCAGAAGTTTTCTTTGAATGGAATTTCTAAATTAATTTACTTGTTTAAATAAATTCAGAACTGGGTAGCATTGTTTTTATTTGCTTCACTATTGAGGTGAATAAGAGCTGATGTGCCACAAATGGAGCCTTCAGATGGCTGCTTTGAGCTTCGTGTTCCCTCAGGGGATGCCAAGATATGTCTCAAGGAGAGATTAATGAGGGGTTTGTAATTACAGAGTGTGCCAAGGTCAGTGCTCACAAGTTTAATTGAACTCTCTCAACTCTACCTCACTGTTCCTTTTCCTTATAATTCTCTGGGCTAGGTCAAATCAGAAACTTTATTTTTCGGTTCAGTATCTCCCGATTCAATCACTTGTAGGAGGTGGTAACTACACTTAGCAGTAAGAATATCACCTTTTTGAAGAGATGTGTATTATGGGAGTGGAAGCACAGCGATACACTGGGTAGGTCAGTGTGGAAGTCGCCTCTGTGCCTTCCTTCTCGCTGGCTTGTGAGCCAGGCCCCCCTCCCCCCCAACCCCCACGCCGGTAGAAGGAGGCAGGTATATGAGTCAAAATCCAGTTCTCTTAAAATCGTTGCTCTTTACCTCTCTATAGATCTTTGTGTGGCAGGGCA