Transcript asmbl_19086

Sequence
Transcript Sequence for observation asmbl_19086 of TGE0000137:
GGGAAGTAGCCCGGGCTGGGGGTGGGTGTTCGCCGCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGGAGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGAGAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAGGGTCAAGTCCTCCATACCAAGGACCAGGCTAAAACCAGATTACACTGCCCCTCCCTGGGCCCTATTGACTTAAAGCAGCCACTGTAATCATGGGCAATATCTTTGGGAACCTTCTGAAGAGCCTAATCGGCAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCTGCCGGGAAGACCACCATCCTCTACAAGCTGAAACTCGGGGAGATTGTCACCACCATCCCGACCATTGGGTTTAATGTGGAGACAGTGGAATATAAGAATATCAGCTTCACAGTCTGGGACGTAGGTGGCCAGGACAAGATTCGGCCCCTCTGGAGACACTACTTCCAGAACACCCAAGGCTTGATATTTGTGGTTGACAGCAATGATCGGGAGCGAGTGAACGAGGCCCGGGAAGAGCTGATGAGGATGCTGGCGGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTGTTTGCAAACAAACAGGATTTGCCGAATGCTATGAATGCTGCTGAGATCACAGACAAGCTGGGGCTGCACTCCCTGCGTCACCGCAATTGGTACATTCAGGCCACCTGTGCTACCAGCGGGGACGGGCTGTATGAAGGCTTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTCTCTGACTACCCCACCCACTCCTGACACACACCTGCTGTCTCCTTACCCCAATTTTCCCTTCTTCCTCTTGAAAGTGGCCAAGGTCCTGGGTATCATGTCCACATGCCCAGCAAGCGCCTTGCCTTCCTCCTCCTCCTCCTCCTCCCTCCTCCCTCCTCCCTCC