Transcript asmbl_18871

Sequence
Transcript Sequence for observation asmbl_18871 of TGE0032237:
GACGCTGTTTACGTAGCGTCTGGGCCGTGCGTAGCGTTAAGTTGGAGCGGTCTCCGCGGCCGCCGCCATTTTGTGCAGTTGCTGGGAAGGAAGGGAGACGCCTCAACCGTGGCACCGCCCGGTTTGAGCGGGACCAGACCTCCCGACTGTCCTAACAACCCCGATTCTCTGAGTTGTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGACAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCGCCATCGGTCATCACTAGACCCGAGCCGCAGGCCCTCCCGAGCTCGGTCATCCGTGCCCCGCTCCCAGATCTTTATCCGTTTGGGACCATGCGTGGAGGCGGCTTTGGGGATCGGGATCGTGACAGGGACCGTGGAGGGTTTGGAGCAAGAGGTGGTAGTGGGCTTCCCCCTAAGAAGTTTGGTAATCCTGGGGAGCGGTTACGAAAAAAGAAGTGGGATTTGAGTGAACTCCCTAAATTTGAGAAGAATTTTTATGTTGAGCATCCAGAAGTAGCAAGACTGACTCCGTATGAGGTTGATGAGCTACGGCGTAAGAAAGAGATTACAGTGAGAGGGGGAGATGTTTGTCCAAAACCTGTCTTTGCCTTCCATCATGCTAACTTTCCACAGTATGTGATGGATGTGCTGATGGATCAGCACTTTACAGAACCCACTCCCATTCAGTGCCAGGGATTTCCTTTGGCTCTTAGTGGCAGGGATATGGTTGGCATTGCACAGACTGGCTCTGGGAAGACATTGGCGTATTTGCTGCCTGCGATTGTTCATATAAACCACCAGCCATACTTGGAAAGAGGAGATGGTCCAATTTGTCTAGTGCTGGCTCCTACCAGAGAGCTTGCGCAGCAGGTGCAGCAGGTGGCTGACGATTATGGAAAATGCTCCAGGTTGAAGAGTACGTGCATTTACGGAGGTGCTCCTAAAGGTCCCCAAATTCGAGACTTGGAAAGAGGTGTTGAGATTTGCATAGCCACTCCTGGGCGCCTAATAGATTTCCTGGAGTCAGGAAAGACAAACCTTCGCCGATGTACTTACCTTGTGTTGGATGAGGCTGACCGGATGCTTGATATGGGCTTTGAGCCCCAGATCCGTAAAATTGTTGATCAAATCAGGCCTGACCGGCAGACACTGATGTGGAGTGCAACCTGGCCGAAGGAAGTGAGGCAGCTTGCAGAGGATTTCCTGCGGGACTACACCCAGATCAATGTGGGCAATCTGGAGCTGAGTGCCAACCACAACATCCTACAGATTGTAGATGTCTGTATGGAGAGTGAAAAAGACCACAAATTGATCCAGCTGATGGAGGAAATCATGGCGGAAAAGGAAAATAAGACTATAATATTTGTGGAGACAAAGAGGCGCTGTGATGACCTCACACGAAGAATGCGCAGAGATGGTTGGCCTGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGATCTGGAAAGGCTCCTATCCTCATTGCCACGGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTCATCAACTACGATTATCCAAACAGCTCAGAGGATTATGTTCACCGTATTGGCCGAACGGCCCGCAGCACCAACAAGGGCACTGCCTATACTTTCTTTACCCCGGGCAACCTGAAGCAGGCTAGAGAGCTGATCAAAGTATTGGAAGAGGCCAATCAAGCCATCAATCCAAAATTGATGCAGCTTGTGGACCACAGAGGTGGCGGCGGAGGAGGGGGAGGCCGCTCACGATACCGGACTACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGACGAGTGTGACCGGAGGCTTCGAGGGGTCAAGGATGGTGGCCGGAGAGATTCTACAAGCTACAGGGATCGTAGTGAAACCGATAGAGCCAGTTATGCTAATGGCAGTGGCTATGGAAGCCCAAATTCTGCCTTTGGGGCACAAGCAGGCCAATACACCTATGCTCAAGGCACCTATGGGGCAGCTGCCTATGGCACCAGTGGCTACACGGCGCAGGAGTATGCTGCTGGCACTTACGGGGCGAGCAGCACTGCCTCAGCAGGGAGGAGCTCTCAGAGCTCCAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAGCCACAGCCACTGATGTCACAGCAGTTTGCACAGCCTCCAGGAGCTACCAATATGATAGGCTACATGGGGCAGACTGCTTACCAGTACCCTCCCCCTCCCCCTCCCCCTCCTCCATCTCGCAAATGAAACTGCATGGCAGGAGTGACTCGTGCAGATGAATTACACATCTAAAGGAACACTGTCTTTTACCCTTCTAGACCTTTTCATTTTTATTTTTTCTTTTCTCAACCATTACGGTTTATCTTTTTTTAATGCAGATAGTTAAAATTTCACTGCCAGGTTTCTTCTGCCCACCCAAAAGATCCAGTCTATAATTACAGATTTTGTAAGAAAAAATATATATACACATAACTGACTGGAAAGAATTAATTTCTTTCCCCCAGCTTAATGCATGTTGAGGATATTGAGCTATTTTTCATCTTAAAGGTATTAGGCACTTTTGTTGGAGCCTGTTTATCCATGGGAGGGTGGGTAGGGAAGGAGGGACTGCTCTGCAGGAAGTGGTATCTGTTCTTTAGACTGCTCTCCTTAGGGAGGAGCCAAGAGGGATTTCCATGCACACTGCCCATGGTGGGTTTAAGTTACTGAAGTTCGATTACTCAGGCCTGATGAATTTTTAAGACTGCTTTGTTGGTCATTTGGCTGATGGCTTCTTATGTGCATTCAACAGTTAAAAATTCCTAATCGATTCTGTCATCATGCCCCCTCCCCACTTGTTCCTGCAGTTATTAAATATTAACCAGGTTAGTGTTGAGTTAGAAATTACATTTCTGAGTTCAAGCGTTGTCTTTTTAAGTTTAAAAAACTATAAAGGGTTGTTTTTACTAGGTAGACTGGCATCTGGGTAGAGGCTGCCTGGGATTTTTATCCCCACATAACCAGGGGCCATCTGAAAGTCATTTTCTAGCCAGATCAGCCACTGAGCGGTAAGCATCAGCGCTCAGCAGAGCCTTCCGAGCAGCATTTAGAAAGCACCTTTGGGAATGATGGACTGCAAGGGAGTGGGCGGATCTTCCTCTTAAACAGTATTCTTAGAGTAGGATTGACCTCATGGGCTGCTCTGCCCACTTGGTCAGGCTCTCCTGAGCAGGACTGCTAAAGAGCTTGCCTCCTCAAAGCCTGGTCTCTGAGGTGCTTTCTAACAGCTGGAGGCACTTGTTCTGGGCTTTCCTTTGCCCTCAGTTTTTCACAGGTAGGTAGTAGCCATGGAGGGCTGAAGCCCAGGCTCTCCTTACTCTCTGGAGTGTGAAGGTAGGGGTGAGCTCGTCTCACCCCTTTATTAAATGCTCCTGGAACTTGGAAGAGCAGCAGATGAAGTTGGAAAGAAAATTCTGCTCTTATCACCTAAACAGGACAGGAGAGCAGATGCCCCAGCGCCTCTAGTAGATGGTAGTGGTGGGGCTAGTGTGTGGCTGTTACCTGGGCCGCTCAAATTCATTCCAGGGAGGAGGCTCCACTGCATTCTTTGGCTGTGCCCTGAGGGTGCCTGCTCCTTTGTACGGTAACAGTCAATTTTGAGGTTTCTTTCAGGAAGAGAAAGGGATGGTTTTGAGGGGCTCAGAAAATAGGATTCAGTGTGTAACATAACAGGTAGGTTGTCAGCATGCTTGGCATTCTTCTGTTTTCCTTACCGTTTTACAGACTATGAAGCTGAGGGGGGATGGTAGGCACAGATGTGTGGCAACCCTGCTCTGTGCTCTGAAACCAAAGTGTGTCCTGTCTTGTCTGTCTCTCACCCTGCCAAAAGCAAGTGTCTAATCACTGATGCTGACCAGCCTGTTACAGATACTTTCTACAACCAAATTCAGATTTATTTTTTATTAAGCATTATACCATGGGCTGTCCTGTGCTCCTGTCACTCTTCAAAAACACCCCTTCTATTACTGCCTCCGGGGATGAAGCAGTAGCTAGGTTGCTTAACCTCCCCTCTCCAGCAGAGGCATAATCCAGATAAGTAGCAGATGTCATATTTCATAAGCTCTTTTGGCCTGGGTACAGCAGAAAACTAGCAGTTTTCCTACTTGGCGCAAGTGACTTGTGCCTCCTTGTCTGTCCTTTGTCAGCACAGGTGCAGGCAAACCCTTCCAGCTGGGTTAATTGCCGTTTATGGTTTACTCACTTAGGGAAAGGGCTTAGGTGTTAGGCTGTGGGCTGCTTCTCCCTAACCATCCATTGTGCAGACTTCTCATCTAAAAAGGTTGGTGGCTTTTGCTTGGGATCAGTGCTCTGCTAACGCCCTTGCTGGTCTCTCCACACATTCCTGTCATTGAGACTTGAATTGTAGGTGTGATGTTATGCACAGGATGCTCAGAGCTATGTTACTACTATTCTTAGTTTGTAAATTGTCCTTTTGATACCATCTTGTTTTCTTTTGTAGGTATAAATAAATACTTGACAATAAA