Transcript asmbl_18531

Sequence
Transcript Sequence for observation asmbl_18531 of TGE0036197:
CGGCGCGGGACGGCGGGAAGGTGACGGCCGGCGCGCAGCCCCGGGCCGCGACGCGATGCCCGGCCGAGCACGAGGAGGACATGTACCGTGCTGCAGATGAAATAGAAAAGGAGAAAGAATTGCTAATACATGAAAGAGGGATATCAGAACCCAGGTTAAGTGTGGCTCCTGAAATGGATATCATGGACTACTGCAAAAAAGAATGGAGAGGAAATACTCAGAAAGCCACATGTATGAAAAAGGGCTATGAGGAAGTGTCTCAGAAATTCACTTCCATAAGGCGAGTCCGTGGTGATAACTACTGTGCACTGAGGGCCACACTGTTCCAGGCCATGAGCCAGCTGGCCGAGCTGCCCCCCTGGCTGCAGGACTTGGAGCTCATACTGTTACCAGAGAAGCTGATAAACAAGTATACCTGGATCAAGCAGTGGAAACTTGGACTGAAATTTGATGGGAAGAGTGAGGACCTGGTTGAAAAAATTAAGGAATCCCTTGCCCTGCTAAGGAAGAAGTGGGTAAGCCTGGCTGCAATGAAAACTGCTGAAGCGAGGCAGACAGCTTGTGATGAGCTGTTCACCAACGAAGAGGAGGAGTACAGCCTCTACGAAGCTGTGAAGTTCCTGATGTTAAACAGAGCCATCGAACTGTACGATGACAAGGAGAAGGGAAAGGAAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCTCCTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTTGAGATGTTCCTTCTTGCCTATGCTGTCCGCCACAGCATCCGGGTGTACCGGCTGTCCAAGTATAACACAGAGGAGTTCATCACAGTCTACCCCACTGATCCCCCCAAGGACTGGCCAATGGTGACCCTCATAGCTGAGGATGATCGGCACTATAACATCCCTGTCAGAGTGTGTGAGGAGACCAGTGTGTGAGGGACACACATGTGACTGCCAAGAGATGCGCATGTGCAGCTCCTCCTCTGGGGGCCTCAGATCTGCAGGTCTCCAAGGACAATCTGGGAGAACTCTCGGGCCCCTGGAGCCAACTTTGGACCATTATGTTCTGAAGACTAGCTGTTGATAATGAGAATTAATTAGCCAAGCCTTCACTCCTTGTTCTGTTATGCAGTGTGTTCCACTGGGGGCTTCAGCACGTGCCTTTGGAAGGTGCAAACTATGTCTCCATAAGGCGGATGCTTTTGGGTCAAAGAAAACTGTTTGGAAAGGAATCTGTCCAATGAAAGTTCTGACGGTAAACTGGTTTTACTTCTCTTTTTAAAA