Transcript asmbl_16973

Sequence
Transcript Sequence for observation asmbl_16973 of TGE0047456:
CGCTCATTCAAAGTCCGGGGGAGCGACCTGGGAAGCGGAATTCGGGGCCTGAACCTCCGTGCCTTGACCTACTGATTGTTCCCTTTGCAGACCCTGCCTTCCTCTCAGTCCACACTCCGAGCCGTAGACGTCGGGTTTCCAGCTCCGTCTGTGCACACATAACTCCAGGAAGCCGCTAGCTCCCGACGATGTCTTCTGTCAAGTTATGGCCTACTGGTGCGTCAGCGGTTCCTCTGGTGAGCCGTGAAGAACTGAAGAAGCTGGAGTTTGTGGGTAAAGGAGGGTTCGGAGTCGTGTTCCGGGCACACCACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTCTGCTCCTGCTGGGGGTCACTGAGGACCTCCAGTGGGACTTCGTGTCCGGGCAGGCTCTGGTGACAAGATTCATGGAGAATGGCTCCCTCGCAGGGCTGCTGCAACCCGAGTGCCCTCGGCCCTGGCCACTCCTCTGTCGCCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCTCCTGCACCGGGACCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAAGGTTAGTCCATCTACAACCTAGTGTAGACTTGGGACCATGTTGAGTACCTGTCCCTCTGAATACAAGACTACACACATGACAAGACCCAACTAGGAGTTTTATTTCTAGTCATACCAGGTGACCCTCCTTACCAGACGCCCTTCTTAACCCCCTGGCTCAGTTCCACAGGCCTAATGC