Transcript asmbl_16971

Sequence
Transcript Sequence for observation asmbl_16971 of TGE0032142:
CGCTCATTCAAAGTCCGGGGGAGCGACCTGGGAAGCGGAATTCGGGGCCTGAACCTCCGTGCCTTGACCTACTGATTGTTCCCTTTGCAGACCCTGCCTTCCTCTCAGTCCACACTCCGAGCCGTAGACGTCGGGTTTCCAGCTCCGTCTGTGCACACATAACTCCAGGAAGCCGCTAGCTCCCGACGATGTCTTCTGTCAAGTTATGGCCTACTGGTGCGTCAGCGGTTCCTCTGGTGAGCCGTGAAGAACTGAAGAAGCTGGAGTTTGTGGGTAAAGGAGGGTTCGGAGTCGTGTTCCGGGCACACCACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTCTGCTCCTGCTGGGGGTCACTGAGGACCTCCAGTGGGACTTCGTGTCCGGGCAGGCTCTGGTGACAAGATTCATGGAGAATGGCTCCCTCGCAGGGCTGCTGCAACCCGAGTGCCCTCGGCCCTGGCCACTCCTCTGTCGCCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCTCCTGCACCGGGACCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAAGCTAGCAGATTTTGGCCTGTCCACGTTTCAGGGAGGGTCCCAGTCAGGGTCAGGATCAGGATCAGGATCCAGGGACTCTGGGGGCACCCTAGCGTACTTGGACCCAGAGCTGTTATTTGATGTCAACCTGAAGGCTTCTAAAGCGAGTGATGTCTACAGCTTTGGGATCCTCGTGTGGGCAGTGCTGGCTGGCAGAGAAGCTGAGTTGGTAGACAAGACTTCACTAATCCGGGAAACAGTGTGTGACAGGCAGAGTCGTCCTCCACTGACAGAGCTGCCTCCAGGTAGCCCTGAGACTCCCGGCTTGGAAAAACTGAAGGAGTTAATGATTCATTGCTGGGGTTCCCAGTCCGAAAACAGGCCATCCTTCCAGGACTGCGAACCAAAAACCAATGAAGTTTACAATCTGGTAAAGGACAAGGTAGATGCTGCTGTCTCCGAGGTAAAGCATTATCTGTCTCAGCACAGAAGCAGCGGCAGAAACTTGTCTGCCAGAGAGCCAAGCCAAAGAGGCACAGAAATGGATTGCCCGAGGGAAACCATGGTTTCTAAAATGCTGGACCGCCTGCATTTGGAGGAACCCTCCGGACCAGTTCCTGGAAAATGTCCTGAGAGGCAAGCACAGGACACATCAGTTGGGCCTGCCACACCAGCAAGGACATCTTCTGACCCCGTGGCTGGCACTCCTCAGATTCCACATACTTTACCCTTCAGAGGCACAACACCTGGGCCAGTCTTTACTGAGACTCCCGGTCCTCACCCCCAAAGGAATCAGGGAGATGGAAGACACGGCACTCCTTGGTATCCCTGGACCCCACCGAATCCAATGACAGGGCCACCGGCTCTCGTCTTCAACAACTGTTCTGAAGTGCAGATTGGGAACTACAACTCCTTGGTAGCACCACCAAGAACTACTGCCTCAAGTTCGGCCAAGTATGACCAAGCACAGTTCGGCAGGGGTAGGGGCTGGCAGCCCTTCCACAAGTAGACTTCAGAGAATCACTGCAAGAGCCTGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAAGACAGTCCTTGCCACTTCCTGAAGCTCACAACATTCTGTGAGGACAGTTGGACCTACACCCAAACTGACTCTTGACCCATCTCCTTAAAGTCAATAAACATAGCATGTTAACTGTGA