Transcript asmbl_16735

Sequence
Transcript Sequence for observation asmbl_16735 of TGE0047426:
CCCCACCGCCCCCTCTCGGGGCCGACCGCGTCGTCAAAGCTGTTCCTTTTCCCCCAACTCATCGGCTGACATCTGAAGAAGTGTTTGATATGGATGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTAAAAGAAGGGCGGGTGGATGAAGAAATTGCACTAAGAATTATCAATGAGGGTGCTGCCATACTTCGGCGGGAGAAAACCATGATAGAAGTAGAAGCTCCAATTACAGTGTGTGGTGACATCCATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACCTGCTAATACACGATACCTTTTTCTTGGTGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTATATTTATGGGTCTTGAAGATTCTATACCCAAGCACATTATTCCTTCTGAGAGGCAACCATGAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAATATTCAGAAAGAGTCTATGAAGCTTGTATGGAGGCTTTTGACAGCTTGCCCCTTGCTGCACTTCTAAACCAACAATTTCTTTGTGTTCATGGTGGACTTTCACCAGAAATACACACACTGGATGATATTAGGAGATTAGATAGATTTAAAGAGCCACCTGCATTTGGACCAATGTGTGACTTGCTATGGTCTGATCCTTCTGAAGACTTTGGAAATGAAAAATCACAAGAACATTTTAGTCATAATACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAACAATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTACAGAAAAAGTCAAACTACAGGGTTTCCTTCATTAATAACAATTTTTTCGGCACCTAATTACTTAGATGTCTACAATAATAAAGCTGCTGTACTAAAGTATGAAAATAATGTGATGAACATTCGACAGTTTAATTGCTCTCCACATCCTTATTGGTTGCCCAATTTTATGGATGTCTTTACATGGTCTTTACCATTTGTTGGAGAAAAAGTGACAGAAATGTTGGTAAATGTTCTGAGTATTTGTTCTGATGATGAACTAATGACAGAAGGTGAAGACCAGTTTGATGTAGGTTCAGCTGCAGCCCGGAAAGAAATCATAAGAAACAAGATCCGAGCAATTGGCAAGATGGCAAGAGTCTTCTCTGTTCTCAGGGAGGAGAGTGAAAGCGTGCTGACACTCAAGGGCCTGACTCCCACAGGGATGTTGCCTAGTGGAGTGTTGGCTGGAGGACGGCAGACCTTGCAAAGTGCAATACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTTGAAGAGGCAAAGGGTTTGGATAGGATCAATGAGAGAATGCCACCCCGGAAAGATGCTGTGCAGCAAGATGGTTTCAATTCCCTGAACACCGCACATACCACTGAGAACCACGGGACTGGCAACCATAGTGCCCAGTGACCAGCGGCTTCCCAGGGACTCTCACATCTTGGGCCCCAAATGGACAGATCACTTCAAGGAGCTGGAGGGGTTGACCAAGGTGATGATAAATGTCATAATCTCTCTGAAGAAACCATTGTGCTTTCTGAGATCCGTGCCCCCTTCCTGGATGGAGGCTTGAGGGCCCTGGGACTTGTGCCGTCTATAAGATTGGGTAATCGCTGCCACAGAGGAGAGCAGTGAGCAAGGGGCTTGGGGCAATTTCCAGTGGAGGATATCTACACCTCCATTTATGCTTGTGGTTCACACATTTACGTTTACAAATGAGATTTCCTTTGTTTTTCCCCTCAGTAGAATTAGACATTTTTCAACCATGACTTTAAATACAATCTTTAGAGATAACGTGGAACTCCCCCCATCACCCTCACCCCATGAAATGTCTTTAAAAGGATGGATTAGCATGGTCTTAAAATATATTTCTGAGGTTACTAGATGTATTTTGACTTGTAGACAAAATCTGAGAAACCCAGTTGGTGTTTATATAAAATGCTGACCTCAGGTTATAGTTCTTAAATGTGGCTAATTCTGTAACATAGTCTTGGTATTTTTCAATTATGAATGCATAAACTATTTCTAAGAAGACTCTTACTTGAACAAAATCCAAAAACCAATTTAGATTCTTTTTTGCCCATATCTTTTGTGATTTACACCCCAGAGATTTAAGGAAAAAACAAAAACAAAACAAAATGAAATTTTAAAATTATGAAGAATTACAGAATTACTCATTTAAGGTACTTTAAAAGAAGTTTGTACATTGTCAAAGTAAATTTTAATTCAAATCATGTCTGTAAAACTTGACGTATTTTGTGTATGCATGTTTTCATTTTGCAAATATTTAATATATAGACCTATGATGTACAGGTACAACATGTATAGGTTACGTAGATATTATGAGAAATTTTAGTTTATTGTGAGTACTCCAGTTGCTTTAAAAACCACCAGGGTGATTTGCTGCTGGCTTTGTATCATCTTTATGTTTAAATGCAAAGGAAATTAAAAATGTCTGGAAATGTTTTTGACTAAGTAATGCAGCCTAGAAGCAATGGTTCTCTTCAACCCTTCAGATGTCTAGTGGAAGCATAAAAGTCAAGACTGCATGTCGAAATTTTACTTTTGATAGTTACAGAACTGCTTGGTTAAACTAAATGGAACCATGTGCTAATTTTACAGTGACTGACCTGTACTGATTACCACTGTAGTTTGGTATTTCCCTTTACTTTGGTGGCCTGCTTCCCTCATGCCCTGGAGTACAGCTCATAGCACCAGGCAGCGGAACCATCTGTTGTTTTGTTTGCCAGAAAGTGCAGCCTGTATGGTCTTCTGTCTAAGTTGGAAATATTATGCATGTGCAGGACTATTCAAGTATTTTATAAACAGTAGCACACAATAAATTCC