Transcript asmbl_16700

Sequence
Transcript Sequence for observation asmbl_16700 of TGE0032086:
CTTCCATCAAGTGGTGGCCTGGGGACTTGGGACGGACAGTCACCCATGCTGTGGTCCTAGCCCATTTGATCTGCTTAGGAGCCCGGCATGGCATGCATGCCTTCATTGTGCCCATCCGGAGCCTAGAGGACCACACCCCACTGCCAGGAATAACAGTTGGGGACATAGGCCCCAAGATGGGCTTCGAAAACATAGACAATGGCTTCCTGCGACTGAACCACGTGAGGGTTCCCAGAGAGAACATGCTCAGTCGCTTTGCAGAGGTCTTGCCAGATGGCACCTACCAGAGGCTTGGGACACCACAGAGCAATTATCTTGGCATGTTGGTGACACGGGTGCAGCTGCTGTATAAAGGATTCCTACCCACCCTCCAGAAGGCTTGCACCATTGCTGTGCGCTACGCAGTAATCCGCCACCAGTCTCGTCTTCGGCCTAGTGACCCAGAGGCAAAAATCCTGGAATACCAGACACAGCAGCAGAAACTCCTGCCTCAGCTTGCTGTGAGCTATGCCTTGCATTTCATGACCACCAGCCTCTTACAATTCTTCCACAGCTCCTACAGTGATATTCTGAAGAGAGACTTCAGCCTCCTGCCTGAGCTCCATGCACTGAGCACTGGCATGAAGGCCATGTCTTCAGACTTCTGTGCCCAGGGAACAGAGATCTGCCGCAGGGCCTGCGGGGGTCATGGCTACTCAAAGCTGAGCGGCCTACCGACACTGGTCACTCAAGCGATAGCCTCTTGCACGTATGAGGGTGAGAATACGGTGCTCTACCTGCAAGTGGCCAGGTTTCTGATGAAGAGCTACCTGCAGGCTCAAGTGTCCCCAGGATCCATACCACAGAAGCCTCTCCCTCAGTCCGTCATGTATCTCGCCACACCAAGACCAGCCAGGTGCCCAGCCCAGACAGCAGCTGACTTCCGCTGCCCAGAAGTCTATACCACAGCCTGGGCATATGTGTCTGCCAGGCTCATAAGAGATGCAACACAGCATACACAGACCCTCATGAGATCCGGGGTTGACCAGTACGATGCTTGGAACCAGACTTCTGTCATACACCTTCAGGCTGCTAAGGCTCACTGCTACTTCCTCACTGTGAGGAATTTCAAGGAAGCTGTGGAGAAACTAGACAACGAACCAGAGATTCAGCGTGTGCTTCAGAACCTCTGTGACCTCTATGCCTTAAACGGTATTCTGACTAACTCAGGGGACTTTCTGCATGATGGCTTCCTGTCTGGGGCCCAAGTGGACATGGCAAGAACAGCCTTCCTAGACCTGCTTCCCTTGATCCGGAAGGACGCCATCTTGTTAACAGATGCTTTTGACTTCTCGGACCATTGTTTAAACTCTGCACTTGGCTGTTATGACGGACACGTCTACCAACGCCTGTTTGAGTGGGCTCAGAAGTCCCCAGCCAATACTCAGGAGAACCCTGCCTATAAGAAGTATATTAGACCACTGATGCAAAGCTGGAAACCCAAGCTGTGAAAAGCCAAAGGATTCAGGACCAAGCAGCACCATGGCCTTCCTATGGCACATATGCATATAAAGAATTTAAAGCACGGGGTGGCGTGCGGCTTGTTCAGATCAGCGAGTAAACTGGTACATGAAAGGATGTTCATCATATTATTCTGCTACTGAGTACATCTGAAACTTTCCCTTGTCTGTTTGTAGTACGTATTTGGCTAAATGCTAGAATTTTGCTTTAAATACAGCAAAAGCTAATAAACTTGTTAGTAACTA