Transcript asmbl_15492

Sequence
Transcript Sequence for observation asmbl_15492 of TGE0032043:
CGCAGCACCCGTCCTCGGTCACTGCTGGTCGCTTCCTGAGCCGCTGCTGGCTCTGTGTCTCTGTCCTCAGCGTTCTCGTCCTCGTCCTCGTCCTCGTCCTACCACGCCATGGAAGGTTACCATAAGCCAGATCAGCAGAAGCTCCAGGCCCTGAAGGACACAGCCAATCGCCTGCGCATCAGCTCCATCCAGGCCACCACCGCGGCAGGCTCAGGCCACCCCACATCATGCTGCAGCGCTGCCGAGATCATGGCTGTCCTGTTTTTCCATACCATGCGTTACAAGGCCCTGGATCCCCGAAACCCTCACAATGATCGATTTGTGCTCTCTAAGGGCCATGCAGCTCCCATTTTATATGCAGTCTGGGCTGAAGCTGGCTTCCTACCCGAGGCCGAGCTGCTGAACCTGAGGAAGATCAGCTCTGACTTGGACGGGCATCCTGTCCCGAAACAAGCCTTCACCGATGTGGCCACTGGCTCCCTGGGCCAGGGCCTGGGAGCTGCTTGCGGGATGGCATACACAGGCAAATACTTTGACAAAGCCAGCTACCGAGTCTATTGCATGCTGGGAGACGGGGAGGTCTCCGAGGGCTCCGTCTGGGAGGCCATGGCCTTTGCTGGAATTTACAAGCTGGACAACCTCGTTGCCATTTTTGACATCAACCGCCTGGGCCAGAGCGACCCAGCCCCGCTGCAGCACCAGGTGGACATCTACCAGAAGCGCTGTGAGGCCTTTGGCTGGCACACCATCATCGTGGACGGACACAGCGTGGAGGAGCTGTGCAAGGCCTTTGGTCAGGCCAAGCACCAACCAACAGCCATCATTGCCAAGACCTTCAAGGGCCGAGGGATCACAGGGATTGAAGACAAGGAGGCGTGGCACGGGAAGCCCCTCCCCAAAAACATGGCCGAGCAGATTATCCAGGAGATTTACAGCCAGGTTCAGAGCAAAAAGAAGATCCTGGCCACGCCCCCTCAGGAGGATGCCCCATCCGTGGACATTGCTAACATCCGAATGCCTACGCCACCCAGCTACAAAGTGGGGGACAAGATAGCCACCCGGAAGGCCTATGGACTGGCCCTCGCTAAGCTGGGCCACGCCAGTGACCGTATCATTGCCCTGGATGGAGACACCAAGAATTCCACCTTCTCGGAGCTCTTCAAAAAGGAGCACCCAGACCGGTTCATTGAGTGCTACATTGCCGAGCAAAACATGGTGAGCATTGCCGTGGGCTGTGCCACACGTGACCGGACAGTGCCCTTCTGCAGTACTTTCGCGGCCTTCTTCACACGGGCCTTCGACCAGATTCGCATGGCCGCCATCTCTGAGAGCAACATCAACCTCTGTGGCTCCCACTGTGGTGTGTCCATTGGGGAAGACGGGCCCTCTCAGATGGCCCTCGAAGACCTGGCCATGTTCCGGTCAGTCCCCATGTCCACCGTCTTTTACCCAAGCGATGGAGTTGCAACAGAGAAGGCAGTGGAGTTAGCAGCCAACACAAAGGGCATTTGCTTCATCCGGACCAGCCGCCCAGAGAATGCCATTATTTATAGCAACAATGAGGATTTCCAGGTCGGCCAAGCCAAGGTGGTCCTGAAGAGCAAGGATGACCAAGTGACAGTGATCGGGGCTGGTGTAACTCTGCATGAGGCCTTGGCTGCTGCAGAGAGTCTAAAGAAAGATAAGATCAGCATCCGGGTGCTGGATCCCTTCACTATCAAGCCCCTGGACAGGAAACTCATCCTAGACTCTGCCCGAGCAACCAAAGGCAGGATCCTCACCGTGGAGGACCACTACTACGAAGGTGGCATAGGAGAGGCAGTGTCTGCTGCCGTAGTGGGTGAACCTGGAGTGACGGTCACTCGCCTGGCTGTCAGCCAAGTACCACGAAGTGGCAAGCCAGCTGAGCTACTGAAGATGTTCGGTATTGACAAGGACGCCATTGTGCAAGCTGTGAAAGGCCTTGTCACCAAGGGCTAGGGAGGGCATGGGATGCTGGGTGGGTGAACTACACATTCCAGGGAGGTTCTGGCAGAGGTGGCGAAGGTGTACTGAGTGGGGAGGTAAATATATGTTTTGAGAAAA