Transcript asmbl_15457

Sequence
Transcript Sequence for observation asmbl_15457 of TGE0032038:
CAGGTCCTCGCCTCTGGGGCTGTCCTGGACATTGCCTAACCCGAGGCCCCGCAGCTCCTGCTCGCCCCGTCCCCGCCGGACGGTCCGAGACCGCTCACCCAAGGAGACCGCCGTGCTCTCGACCCACGTGGTCACTCCGGAGCAGGTGGGAGTGGGCAGCGGGCGGAGCGGCAAGGACAGGCGCGGTAGACAGCCCGGGCGGCCGCGGCGGGGACCTGGCTGGGGGAGGCCAGGCTTGCGGCGGGGCGCAACGGTGTCTCCTTCACTTCGCCCTCCAGCCGCGGTGGCTGCAGCGCAACTTTCAGATAGCGGAGTGGCCTCAGCTGCGAGCCGAGCGGTGGCGGCAGCGCCCCTCAGGACACCCGCAGATCACCTTTTCCCCGCGACTTCGCCATGGCTGAGTGCTGTGTACCGGTATGCCCACGGCCGATGTGTATCCCTCCACCCTATGCTGACCTCGGCAAAGCTGCCAGAGACATTTTCAACAAAGGATTTGGCTTTGGGCTGGTGAAGCTGGATGTGAAGACGAAGTCATGCAGCGGTGTGGAATTTTCAACATCTGGCTCATCTAATACAGACACTGGTAAAGTTAGCGGGACCTTGGAGACCAAGTACAAATGGTGTGAGTATGGTCTGACTTTCACAGAGAAGTGGAACACCGATAACACTCTGGGGACAGAGATTGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACTTTTGACACCACCTTTTCACCGAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTGCTTACAAGAGGGAGTGTATAAACCTCGGCTGTGATGTTGACTTTGATTTTGCTGGACCTGCCATCCATGGGTCAGCTGTCTTTGGTTACGAGGGCTGGCTTGCTGGGTACCAAATGACCTTTGACAGTGCCAAGTCAAAGCTGACAAGGAGTAACTTTGCAGTCGGCTACAGGACTGGGGACTTCCAGCTACACACAAATGTAAATAATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTATGTGAAGATTTTGACACTTCAGTAAACCTCGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATACCAGTTGGATCCTACTGCTTCTATCTCTGCAAAGGTCAACAACTCTAGTTTAATTGGAGTGGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTGTCTGCTCTGGTAGACGGGAAGAGCTTTAATGCTGGAGGCCACAAACTTGGGCTTGCCTTGGAATTGGAGGCTTAATCCAGTTAAAAGAAACCTCTGGGAACGAATATCAGAAGATTTGGCCTTAATATATTTCCATGCGACCAGCAGGCTCCCCTTCCTTCCCCCAGAAGGTGATCACATCAAAGGATGATGAAGCAAGAGCTGTATTTTAAATATTTAGACAGTCACTGTTGGCTGGTTCCTAGTTGGATGGTTATCAGTGCTGCCGTGGTGCGGCCCCCTATACATTATTTAAATGTATTTAACTGTTAAATGTGCTACCCACCAATGATGAAATAGACGTTTATGAAAACCGTGCCATGGTGTGCATGTTTGTTTTATGTTCCTTTTAACATTGACTATTGTACTGAATGAGATGGATCAGTGGCTGTTTTAAGATGAGGTAAAAGATTTTTTTTTGTTATATTCACCCATCATTAGAATTACTTTGGTAACCCCAAACATGACAAATTATGAATAAAACAAGTGTACATAACTAATGGCTCACGTATGTGCAGTTACAGATTGCCAGCCTAGGGTCTAATCTTCTTGGCAAATACTTTTTTCTGGTGAGCATTTTGCTCTTTACCTAAACCTGTGCAACCAAATTCCTTGTGTCCCTAGCATAATCCACGAGGTCTTTGAGATTACAATAAAAT