Transcript asmbl_13933

Sequence
Transcript Sequence for observation asmbl_13933 of TGE0047329:
CAGACTCTGCATCATGAATACTCTGTCTGAAGGAAATGGCACCTTTGCCATCCATCTTTTGAAGATGCTATGTCAAAGCAACCCTTCCAAAAATGTATGTTATTCTCCTGCGAGCATCTCCTCTGCTCTAGCTATGGTTCTCTTGGGTGCAAAGGGACAGACGGCAGTCCAGATATCTCAGGCACTTGGTTTGAATAAAGAGGAAGGCATCCATCAGGGTTTCCAGTTGCTTCTCAGGAAGCTGAACAAGCCAGACAGAAAGTACTCTCTTAGAGTGGCCAACAGGCTCTTTGCAGACAAAACTTGTGAAGTCCTCCAAACCTTTAAGGAGTCCTCTCTTCACTTCTATGACTCAGAGATGGAGCAGCTCTCCTTTGCTGAAGAAGCAGAGGTGTCCAGGCAACACATAAACACATGGGTCTCCAAACAAACTGAAGGTAAAATTCCAGAGTTGTTGTCAGGTGGCTCCGTCGATTCAGAAACCAGGCTGGTTCTCATCAATGCCTTATATTTTAAAGGAAAGTGGCATCAACCATTTAACAAAGAGTACACAATGGACATGCCCTTTAAAATAAACAAGGATGAGAAAAGGCCAGTGCAGATGATGTGTCGTGAAGACACATATAACCTCGCCTATGTGAAGGAGGTGCAGGCGCAAGTGCTGGTGATGCCATATGAAGGAATGGAGCTGAGCTTGGTGGTTCTGCTCCCAGATGAGGGTGTGGACCTCAGCAAGGTGGAAAACAATCTCACTTTTGAGAAGTTAACAGCCTGGATGGAAGCAGATTTTATGAAGAGCACTGATGTTGAGGTTTTCCTTCCAAAATTTAAACTCCAAGAGGATTATGACATGGAGTCTCTGTTTCAGCGCTTGGGAGTGGTGGATGTCTTCCAAGAGGACAAGGCTGACTTATCAGGAATGTCTCCAGAGAGAAACCTGTGTGTGTCCAAGTTTGTTCACCAGAGTGTAGTGGAGATCAATGAGGAAGGCACAGAGGCTGCAGCAGCCTCTGCCATCATAGAATTTTGCTGTGCCTCTTCTGTCCCAACATTCTGTGCTGACCACCCCTTCCTTTTCTTCATCAGGCACAACAAAGCAAACAGCATCCTGTTCTGTGGCAGGTTCTCATCTCCATAAAGACACATATACTACACAGGGAGAGTTCTCTCTTCAGTATCCCTACCACTCCTACAGCTCTGTCAAGATGGGCAAGTAGGGGGAAGTCATGTTCTAAGATGAAGACACTTTCTTCTTGTCAGCCTGATCTTATAATGCCTGCATTCAACTCTCCCTGTCTTGAATGCATCTATGCCCTTTACCAGGTTATGTCTAATGATGCCAAATACCTTCTGCTATGCTATTGATTGATAGCCTAGCCAGTAATTTATAGCCAGTTAGAACTGACTTGACTGTGCAAGAATGCTATAATGGAGCTAGAGAGAAGGCACAAACACTAGGAAAGGTTGCTGTTTTTGCAGAGGACACAGGGACATTTCCCACCACTCACATGGCTGCTTACAACCTCTGGAAATTCCAGTTTCTGTCCATGACTTGATTCCTTTCTTTGGCTTCTACTGGCTCCAGCATCCTGCACATACATGTATCGTCATTCAGTTACACACAAACAAGTAAAATTTTAAAAATAAATAAAAATTTAAAGAGAGAGTCTAAAATTTTAGTAATGGTTAGATAATAGCTGCTATTGTGCCTTTTTCAGGTTTTAATGTCATTATTCTTGTGTATAAAGTCAATAATTTATAGGAAAACATCAGTGCCATGCTGTGATCTTATCTTCATCCCCTTTCAAACACATTGTTTAACCATCAAGCAGTGACTCTCCATTCTTCCTCCCTTTGGACATATAACCACCAATCTTCTCTCTGTCTCTGTAGCTTTATCTATTTTGGACATTTTATATAGACTGCCTCTTTGCTATCTTGATAATGTCCTTTGATGCATACAGATTGCTTTTTTTCCAGTGATGTTCTCCTTATTTAATACTGTTCTGATCATGAGGTATGCATGCTGCAGCTAAGAATCTCACTACTAAAGTCAAGTATAGAAATAACTGTTCTTATGTTTTCCTCCAAGGCCTTCATGGATTATACCTTATATATCTAG