Transcript asmbl_13453

Sequence
Transcript Sequence for observation asmbl_13453 of TGE0031913:
CCGGTCTTGCCCTGCAGTTTCTGCTGGGCCTAAGCCTCCGGGCTCAGTTTGACCACAGTATCTAGCTATGGCGGCAGTGACCTGGAGTCGGGCTCGATGCTGGTGTCCGAGATGCATGCTGTTCTGATCAACATGAGTTGGAGCCAATCAGTAATCCTGTTGCTGCAGAAATAAAAGGGCAAGGAACAAACAGAAACCACTATTTGTAGTGTCCTGCAGGTCTTCAGATTACAAGTGGCTAAACTGCACTTGGGCAGACCAACAATGAGAGCCAGTCAGCAGGACTTTGAAAATGCATTGAACCAGGTGAAACTCTTGAAGAAGGACCCGGGAAACGAAGTGAAGCTAAGACTCTATGCACTGTACAAGCAGGCCACAGAAGGACCCTGTAATATGCCTAAGCCTGGTATGCTTGACTTTGTCAACAAAGCCAAGTGGGATGCATGGAATGCCCTGGGCAGCCTACCCAAGGAAACTGCCAGGCAGAACTATGTGGATCTCGTATCCAGTTTGAGTTCCTCATCTGAAGCCCCGAGCCAGGGAAAGCGTGGAGCTGATGAGAAAGCCCGGGAGTCCAAAGACATCCTGGTAACTTCTGAAGATGGTATCACGAAGATCACGTTCAATCGGCCCACCAAAAAGAATGCCATATCCTTCCAGATGTATCGGGATATTATACTCGCACTTAAAAATGCCAGCACTGATAACACTGTCATGGCTGTTTTCACAGGAACTGGTGACTACTACTGCAGTGGGAATGACCTGACTAACTTCACTAGTGCCACTGGGGGGATAGAGGAGGCAGCTAGCAACGGTGCTGTGTTACTGAGGGACTTTGTAAACAGTTTTATAGACTTTCCCAAGCCTCTGGTTGCGGTAGTAAATGGCCCAGCTGTGGGAATCTCTGTCACCCTTCTGGGACTATTTGATGCTGTCTTTGCATCAGACAGGGCAACGTTTCATACTCCATTCAGCCAACTCGGCCAGAGCCCGGAAGCATGCTCCTCTTACACGTTTCCGAAGATGATGGGCTCAGCAAAGGCAGCTGAGATGCTTCTCTTTGGGAAGAAGCTGACAGCAAGAGAGGCCTGGGCTCAAGGCCTTGTCACTGAAGTTTTCCCTGAGAGCACTTTTGAGACAGAAGTCTGGACCAGGCTGAAAACATATGCGAAGCTCCCGCCAAACGCCATGAGAATTTCCAAAGAGTTAATCAGAAAAAATGAGAAAGAAAAGCTCTACGCAGTCAACGCTGAAGAGTGCACTACTCTGCAAGCAAGGTGGCTGTCAGAGGAGTGCATGAACGCAATCATGAGCTTCGTCTCCAGAAAACCAAAGCTGTGAAGACCACCACAGCAGCTAGACTCCTCATAGGGAGCATGGGCTGGGAGGTCCAGTTTCGAGGACTCAAACGACACATGCTTCTCTGTGCCTTTTCCTTGATTAACGTAGCAATTATGATGAGAATTCTTCACAGTACTGATAAATAAAACTTTTCATAAATCAA