Transcript asmbl_12290

Sequence
Transcript Sequence for observation asmbl_12290 of TGE0047238:
GATCCAGAAGATAAAGAGGGAGAAAGAAGAACGGGGGGAAGCAGTTGATGAAGGAGAGATTGCTGAGAACCTACCTGAGCAGGAGATTCTGATCCAGAGTGTCTGCGAGACAATGGTGCCCAAGCTGGTGGCAGAAGATATCCCGCTGCTCTTCAGCCTCCTGTCTGACGTGTTTCCTGGAGTCCAGTACCACCGTGGGGAGATGACAGCCCTTCGAGAAGAGCTGAAGAAAGTGTGTCAGGAGATGTACTTGACATATGGCGACGGAGAAGAAGTTGGCGGGATGTGGGTTGAAAAGGTTCTCCAGCTCTATCAGATCACGCAGATTAACCACGGCCTGATGATGGTTGGGCCTTCAGGAAGTGGGAAGAGCATGGCCTGGCGAGTGCTGCTGAAGGCTCTAGAGAGGCTTGAGGGTGTGGAGGGCGTGGCCCACATAATTGACCCCAAGGCCATCAGCAAAGACCACCTCTACGGAACCTTGGATCCCAACACCAGGGAGTGGACAGACGGACTCTTCACACACGTGCTGAGAAAGATCATAGACAATGTGAGAGGTGAGCTGCAGAAACGCCAGTGGATTGTCTTTGATGGCGATGTGGACCCCGAGTGGGTGGAGAACCTGAACTCCGTGCTGGATGACAACAAGCTCCTGACGCTGCCTAATGGAGAGCGCCTTAGCCTGCCTCCCAATGTGCGAATAATGTTTGAAGTGCAGGACTTGAAATACGCGACGCTGGCCACGGTGTCTCGCTGTGGCATGGTGTGGTTCAGTGAGGACGTCCTGAGCACAGACATGATCTTCAATAACTTCCTGGCCAGGCTGCGCAGCATTCCCCTGGATGAAGGGGAGGACGAGGCACAGCGTAGGCGAAAAGGCAAAGAAGACGAGGGCGAAGAGGCCGCTTCTCCAATGCTGCAGATTCAAAGAGATGCAGCAACGATCATGCAGCCGTACTTCACGTCCAACGGCCTGGTCACCAAGGCGCTGGAGCACGCCTTCAAGCTGGAGCACATCATGGACCTGACGCGCCTGCGCTGCCTGGGCTCGCTCTTCTCCATGCTGCACCAGGCCTGCCGCAACGTGGCGCAGTACAATGCCAACCATCCTGATTTCCCCATGCAGATTGAGCAGCTGGAGCGCTACATTCAGCGCTATCTGGTTTACGCCATCCTCTGGTCCTTATCTGGAGACAGCCGGCTGAAGATGAGAGCAGAGCTGGGCGAGTACATCCGGAGGATCACCACTGTGCCGCTGCCCACTGCGCCCAACGTCCCCATCATTGACTATGAGGTGTCCATCAGTGGAGAGTGGTCGCCGTGGCAGGCCAAGGTGCCTCAGATTGAAGTGGAGACACACAAGGTGGCAGCCCCAGATGTCGTCGTGCCAACCTTAGATACAGTCCGCCATGAAGCTCTCCTGTACACTTGGCTGGCTGAACACAAACCCCTGGTCTTATGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGTGCTCTCCGGGCCTTGCCTGACATGGAGGTTGTGGGCCTAAACTTCTCAAGTGCCACTACACCAGAGCTGTTGCTGAAGACGTTTGACCACTACTGCGAATACAGGCGTACACCTAACGGTGTTGTCTTGGCTCCTGTTCAGCTTGGAAAGTGGCTGGTCTTGTTCTGTGATGAAATCAACTTGCCCGATATGGATAAATACGGCACACAGAGAGTCATCTCCTTCATCAGACAGATGGTGGAGCATGGAGGCTTCTATCGTACCTCAGACCAAACGTGGGTAAAGCTAGAGAGAATCCAGTTTGTTGGGGCTTGCAATCCACCCACTGACCCTGGGAGAAAGCCCCTCTCACACAGGTTCTTGCGCCACGTGCCTGTTGTATATGTGGATTACCCAGGACCAGCCTCCCTGACGCAAATCTATGGCACTTTTAACCGCGCCATGCTGAGGCTCATTCCCTCGCTCCGTACCTATGCAGAACCCCTCACTGCCGCCATGGTGGAGTTCTATACCATGTCACAGGAGCGGTTTACTCAGGACACACAGCCACACTATATCTACTCGCCCCGTGAGATGACTCGGTGGGTAAGAGGAATCTTTGAAGCACTGAGACCCCTGGAGACATTGCCTGTTGAAGGTCTCATTCGTATTTGGGCACATGAAGCCCTCCGTCTCTTCCAAGACAGGCTTGTGGAGGATGAGGAGCGGCGCTGGACTGACGAAAACATTGACATGGTTGCCTTGAAGCACTTCCCTAACATAGACAAAGAGAAAGCCATGAGCCGGCCTATCCTGTACAGCAACTGGCTGTCAAAGGATTATATCCCAGTTGACCAAGAAGAGCTAAGGGATTATGTCAAGGCTAGGCTGAAGGTCTTCTATGAAGAAGAACTTGATGTTCCCTTGGTCTTATTCAATGAAGTTCTGGACCATGTGCTGAGGATCGACAGAATATTCCGACAACCTCAAGGCCATCTGCTTCTGATTGGTGTTAGTGGAGCTGGAAAAACCACCCTGTCTCGCTTTGTCGCCTGGATGAATGGCTTGAGTGTATACCAGATTAAGGTCCACAGGAAGTACACTGGGGAAGACTTCGATGAAGATCTTAGGACAGTGCTGAGACGGTCTGGCTGTAAAAATGAAAAGATAGCATTCATAATGGATGAGTCCAACGTCTTAGATTCCGGATTCCTGGAACGAATGAATACCCTTCTGGCTAATGGCGAGGTTCCTGGGCTCTTTGAAGGGGATGAGTATGCCACGCTGATGACACAGTGCAAAGAGGGGGCCCAGAAGGAGGGGCTCATGCTGGACTCCCACGAGGAGCTCTACAAGTGGTTCACCAGCCAGGTGATCCGCAACCTGCACGTGGTCTTCACCATGAACCCGTCCTCAGAGGGGCTCAAGGACAGGGCGGCCACCTCACCAGCCCTTTTCAACAGGTGTGTGCTGAACTGGTTTGGTGACTGGTCCACTGAAGCACTGTATCAAGTCGGCAAAGAATTCACCAGTAAGATGGACCTGGAGAAGCCGAACTATATAGTGCCTGACTACATGCCAGTTGTGTATGATAAACTGCCGCAGCCCCCAACACACCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTCCATCAGACTCTTCACCAGGCTAATGCGCGCCTGGCGAAGCGAGGTGGCAGAACGATGGCCATCACACCTCGGCACTACCTGGACTTCATCAACCACTACGCCAACCTCTTCCATGAGAAGCGCAGCGAGTTGGAGGAGCAGCAGATGCACCTGAATGTTGGGCTCCGAAAAATCAAAGAGACCGTGGACCAGGTGGAAGAACTGCGCCGTGACCTGAGGATCAAGAGCCAAGAGCTGGAGGTCAAGAACGCAGCGGCCAATGACAAGCTGAAGAAAATGGTGAAAGACCAGCAAGAGGCTGAGAAGAAGAAGGTCATGAGCCAAGAAATCCAGGAGCAGCTACACAAACAGCAGGAAGTGATCGCAGACAAGCAGATGAGTGTCAAGGAGGACCTGGATAAAGTGGAGCCTGCTGTCATCGAGGCCCAGAACGCTGTGAAGTCCATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCAGCTGTGAAGCTGGCTCTGGAGTCCATCTGCCTGCTGCTTGGTGAGAGCACCACGGACTGGAAGCAGATCCGCTCCATCATCATGAGAGAGAACTTCATCCCCACCATCGTCAACTTCTCGGCTGAGGAGATCAGTGATGCCATACGAGAGAAGATGAAGAAAAACTACATGTCCAACCCCAGTTACAACTATGAGATCGTCAACCGGGCTTCCCTGGCTTGTGGTCCTATGGTGAAGTGGGCGATTGCACAGCTCAATTATGCAGACATGTTAAAGCGAGTGGAGCCCCTGAGGAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAAGCCAATGAGGTGGAGCAGATGATCAGGGACCTGGAAGCCAGCATTGCCCGCTACAAGGAGGAGTACGCTGTCCTCATCTCTGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTGGAAGCAAAGGTAAACCGGAGCACTGCACTTCTAAAGAGTTTATCTGCCGAAAGGGAACGTTGGGAAAAGACGAGTGAAACTTTCAAAAACCAGATGTCTACCATTGCTGGGGACTGCCTCCTGTCGGCGGCCTTCATTGCTTACGCTGGCTACTTTGACCAGCAAATGCGCCAGAACTTGTTCACCACCTGGTCTCATCACTTACAGCAAGCCAACATCCAGTTCCGCACAGACATTGCAAGGACGGAGTACCTCTCCAATGCTGACGAACGCCTCCGCTGGCAGGCCAGCTCTCTGCCTGCCGACGACCTGTGCACAGAGAATGCCATCATGCTAAAACGATTCAATAGGTACCCGCTGATCATCGACCCCTCCGGACAGGCCACAGAATTCATCATGAATGAATATAAGGACCGGAAGATCACAAGGACCAGCTTCTTAGATGATGCCTTCCGGAAGAATTTGGAGAGTGCTCTGAGATTTGGCAATCCCCTTCTTGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAATCCAGTACTGAACCGTGAAGTTCGGCGAACAGGAGGGAGGGTGCTGATTACCCTCGGTGACCAAGACATAGACCTGTCACCATCCTTTGTCATCTTTCTGTCTACCCGAGACCCAACTGTGGAGTTCCCACCAGACCTCTGCTCCCGGGTGACCTTTGTGAACTTCACCGTCACCCGCAGCAGTTTACAGAGCCAGTGTCTCAATGAAGTGCTTAAAGCAGAAAGGCCAGACGTGGACGAGAAGCGCTCCGACCTCCTGAAACTGCAAGGGGAGTTCCAACTCCGTTTACGGCAGCTTGAAAAGTCTCTGCTCCAAGCTCTGAATGAGGTAAAAGGCCGCATTCTGGATGACGACACCATCATTACAACCCTGGAGAATCTGAAGCGGGAAGCTGCCGAGGTTACCAGAAAGGTGGAGGAGACAGATATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTGCCGCTGTCCACTGCCTGCAGCAGCATCTACTTCACTATGGAGTCCTTGAAGCAGGTTCACTTCCTGTACCAGTACTCTCTGCAGTTCTTCCTGGACATCTACCACAACGTGCTGTATGAGAACCCCAACCTGAAGGGTGCCACCGATCACACACAGCGCCTCTCCATCATAACCAAGGACCTCTTCCAGGTGGCCTTTAACCGAGTGGCTCGAGGCATGCTGCACCAGGACCACATCACCTTCGCCATGCTGCTAGCGAGGATCAAGCTGAAAGGCACCGTGGGGGAGCCCACCTATGATGCAGAGTTCCAGCACTTCCTCAGAGGGAAGGAGATTGTGCTGAGTGCTGGCTCCACCCCCAAAATCCAGGGCCTGACCGTAGAGCAGGCAGAAGCTGTCGTGAGGTTGAGCTGTCTGCCTGCATTTAAAGATCTGATTGCCAAGGTGCAGGCAGATGAGCAGTTTGGCATTTGGCTGGATAGCAGTTCACCAGAGCAGACCGTGCCATACCTCTGGAGCGAGGAAACGCCTACAACTCCCATTGGGCAGGCCATCCACCGCCTGCTCCTGATTCAAGCCTTCCGACCCGACCGCCTGTTGGCCATGGCCCACATGTTTGTTTCCACAAACCTCGGAGAGTCCTTCATGTCCATCATGGAGCAGCCTCTCGACCTCACCCACATTGTGGGCACAGAGGTGAAGCCAAACACACCTGTCCTGATGTGCTCTGTGCCTGGGTATGATGCCAGCGGACATGTTGAGGACCTCGCAGCAGAGCAGAACACGCAGATCACGTCTATTGCCATCGGCTCAGCAGAAGGCTTTAACCAAGCAGATAAGGCCATCAACACCGCCGTGAAGTCAGGCAGGTGGGTGATGTTGAAGAACGTGCACCTGGCCCCGGGCTGGCTGATGCAGCTGGAGAAGAAGCTGCACTCCCTGCAGCCCCACGCCTGCTTCCGACTTTTCCTCACCATGGAGATCAACCCCAAGGTGCCCGTGAACCTGCTCCGTGCTGGTCGGATCTTTGTGTTTGAGCCACCACCCGGAGTGAAAGCCAACATGCTGAGGACATTTAGCAGCATCCCTGTCTCTAGGATATGCAAGTCTCCAAATGAGCGCGCCCGCTTGTATTTCCTGCTGGCTTGGTTCCATGCCATCATCCAAGAGCGCCTGCGCTATGCTCCACTGGGGTGGTCAAAGAAGTACGAATTTGGAGAATCTGACCTTCGATCAGCTTGTGACACGGTGGACACGTGGCTGGACGACACAGCCAAGGGCCGGCAGAACATCTCACCGGATAAGATCCCATGGTCTGCCCTGAAGACCCTGATGGCGCAGTCCATCTATGGTGGGCGGGTGGACAATGAGTTCGACCAGCGTCTGCTCAACACCTTCCTGGAGCGGCTGTTCACCACCCGCAGCTTCGACAGTGAATTCAAGCTGGCGTGCAAGGTTGACGGGCACAAGGACATCCAGATGCCTGATGGTATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGCTGCTGCCTGACGCCCAGACACCCTCATGGCTGGGCCTCCCCAACAATGCTGAAAGGGTCCTGCTTACCACCCAAGGCGTGGACATGATCAGCAAGATGCTGAAGATGCAGATGCTGGAGGACGAGGATGACCTGGCCTACGCAGAGACGGAGAAGAAGGCAAGGACGGACTCCACCTCCGATGGCCGTCCAGCCTGGATGAGGACACTGCACACCACGGCGTCCAACTGGCTGCACCTCATCCCACAGACACTGAGCCCCCTGAAGCGCACCGTGGAGAACATCAAGGATCCTTTGTTTAGGTTCTTTGAGAGAGAAGTAAAGATGGGGGCCAAGTTACTCCAAGATGTGCGCCAAGATCTTGCTGACGTCGTTCAAGTGTGCGAGGGGAAAAAGAAGCAGACAAACTACCTGCGCACGCTCATCAATGAGCTGGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCATTACACAGTGCCTGCAGGCATGACTGTGATCCAGTGGGTGTCAGATTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACAAGCAGCTGCATCTGGTGGTGCCAAGGAACTGAAGAACATCCACGTGTGCCTGGGTGGCCTGTTTGTACCTGAGGCCTACATCACTGCCACCAGACAGTATGTGGCACAAGCTAACAGCTGGTCCCTGGAGGAACTCTGCCTGGAAGTCAATGTCACCGCCTCACAGAGTGCCACCCTTGATGCCTGCAGCTTTGGAGTCACAGGTCTGAAGCTCCAAGGGGCCACGTGCAGCAACAACAAGCTATCACTCTCCAATGCCATCTCCACAGTCCTCCCCCTCACACAGCTGCGCTGGGTGAAACAAACAAGCGCCGAGAAGAAGGCCAGCGTGGTGACCTTACCTGTCTACCTGAACTTCACCCGGGCAGACCTCATCTTCACCGTGGACTTTGAAATTGCTACAAAGGAAGATCCTCGCAGCTTCTATGAGCGTGGAGTTGCCGTTCTGTGCACTGAGTAAAGCTAGACTTTTCTCCAGTCCTCTTTCTGGAATAGGAAACTCCCAATATTTAACCTTCATTCATCCTTAACGGTGTGGAAGGGTTGATGGACTGGAAAGCAAGTGGTTGGTTCGCGTTGGCGGGTGACAGGTGCTGCGGTTGGAGACGGTGGGATGGGAGAAGAGAAGAGTGCGCTGTCCGAGGGCTGACCGAATGGCTGGGTTTAGTAAATAAAACACTAAGCATGACGGGCTCCCGCCTCTTGCCGCTCTGCTCAGTCTGCTGTGGGAATCCTTGC