Transcript asmbl_12248

Sequence
Transcript Sequence for observation asmbl_12248 of TGE0031860:
GGTGGATGCACTTCCGGCGGTGGCGATTTGGAGGACTGAAGGAAGATGGGTCAAAGCCAGAGTGGTGGCCATGGTCCTGGGGGTGGCAAGAAGGATGACAAGGACAAGAAAAAGAAATACGAACCTCCTGTCCCAACTAGAGTGGGGAAAAAGAAGAAGAAAACAAAGGGACCAGATGCTGCCAGCAAACTGCCACTGGTAACACCTCACACCCAGTGCCGCCTGAAATTACTGAAGCTAGAGAGAATAAAAGACTATCTTCTCATGGAGGAGGAATTCATTAGAAACCAGGAACAGATGAAACCATTAGAAGAAAAGCAAGAGGAGGAAAGATCAAAAGTGGATGATCTCAGGGGGACCCCCATGTCTGTAGGAACCTTGGAAGAGATCATTGATGATAATCACGCCATTGTGTCCACATCTGTGGGCTCAGAACACTACGTCAGCATCCTGTCGTTTGTAGACAAGGATCTGCTGGAACCAGGCTGCTCCGTCCTGCTCAACCACAAGGTGCATGCTGTGATAGGGGTGCTAATGGATGACACGGATCCCCTGGTCACAGTGATGAAGGTGGAAAAGGCCCCCCAGGAGACCTACGCAGATATTGGGGGACTGGACAACCAGATCCAAGAAATTAAGGAGTCTGTGGAGCTCCCGCTTACCCATCCTGAGTATTACGAGGAGATGGGGATAAAGCCCCCTAAGGGGGTCATTCTCTACGGTCCGCCAGGAACAGGTAAAACTCTATTGGCCAAAGCAGTAGCGAACCAGACTTCAGCCACTTTCTTGCGAGTGGTTGGCTCAGAGCTTATCCAGAAGTACCTAGGTGACGGGCCCAAACTTGTCCGGGAGCTCTTCCGGGTCGCTGAGGAGCATGCGCCGTCCATCGTGTTCATTGATGAGATCGACGCCATTGGGACCAAAAGATATGATTCAAATTCTGGAGGTGAGAGAGAAATTCAGCGAACAATGTTGGAACTGTTGAACCAGTTGGATGGATTTGATTCGAGGGGAGATGTAAAAGTTATCATGGCCACAAACCGAATAGAAACTTTGGATCCAGCACTTATCAGGCCAGGCCGCATTGACAGAAAGATCGAGTTCCCCCTGCCGGATGAGAAGACCAAGAAGCGTATCTTCCAGATTCACACCAGCAGGATGACACTGGCTGATGATGTAACCTTGGATGACTTGATCATGGCAAAGGATGACCTCTCTGGGGCCGACATCAAGGCAATCTGTACAGAAGCTGGCTTGATGGCCTTGCGGGAACGCAGAATGAAAGTAACAAATGAAGACTTCAAAAAATCTAAAGAGAATGTTCTTTATAAAAAACAAGAAGGCACCCCTGAGGGGCTCTATCTCTAGTGGCCCACAGTCGTCCTCAGGGATGGGGAGCTGTCCCCAGGAACCCATTCTCCAGTTCAGGTTTGCCAGTAGAAAGCCTGTATCGTGGAGGACACTGTGCCTCCATCTGTTGTTGGTCATTGTGCCGTGCTGCTCTCTACTCCCAATAAAGGATTGGCCTGGTTTGCTTTCT