Transcript asmbl_12158

Sequence
Transcript Sequence for observation asmbl_12158 of TGE0005279:
CGTCCCTTCCATTTTGTGCAACGTCCGAGCTGCTAAGTGCGTCAGTTGTGGAGAGACTGTAGACGAGTTGGGTTCGTGTGTATGTGTGTTGTGTGTGTGTTTGTGTAGGGAGGCAGACAGCTCCGTCGCAGACTACGGACCTCTCCGGGGTCTCAGCCGCCAAAGACCCTGTCCGGTAGGTGAGTGGCACGCTTTGAGGGCAAGGCTTCTCGGATCGAGGCTTCTTCATGGCCGCTCGGGTCGCAAGTGGCCGGGGCTTCGCTCTTTGCGGAGGACGGCGACTCAGAGAGCGCAGTTGATTTGAGGAAACACTAGCCGGGCATCATGAGTGGCTGTCGAGTGTTCATTGGGAGACTAAATCCAGCAGCGAGGGAGAAAGATGTGGAAAGATTCTTCAAGGGTTACGGACGGATCCGAGATATTGACTTGAAAAGAGGTTTTGGTTTTGTGGAATTTGAGGACCCAAGGGATGCAGATGATGCTGTTTATGAACTTGATGGGAAGGAACTTTGCAGTGAAAGGGTGACGATTGAACATGCCCGGGCTCGGTCTCGAGGTGGAAGAGGTAGAGGACGATACTCCGACCGTTTTAGCAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCACCTGTAAGAACAGAAAATCGACTTATAGTTGAGAATTTATCCTCAAGAGTCAGCTGGCAGGTTTGTTGAAATACAGTTTTGAGATATTTTTTAATGTGGCATTTAAAAGTGTTAATGGGTAGTTAATGTTTTATTAATATATATCTTATTAAATGCTTTATCTTAAATTAATTT