Transcript asmbl_11343

Sequence
Transcript Sequence for observation asmbl_11343 of TGE0031747:
GCGGCGCGCGCCTTACATCCGGTTCCCGCCGCGGCTTGCAGTTGTCTTTCTGCGGAATCCGGATCATGGCGGCTAACGCCACGATGGCGACGTCTGGCTCGGCGCGGAAGCGGCTGCTCAAAGAGGAGGACATGACCAAAGTGGAGTTCGAGACGAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGAGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTGAAAAACCTTCAGCGATTCAGCAGCGTGCTATCAAGCAGATAATTAAAGGGAGAGATGTCATTGCACAGTCTCAGTCTGGCACAGGCAAGACGGCCACCTTCAGTGTCTCAGTGCTGCAGTGCTTGGATATCCAGGTTCGAGAAACCCAAGCTTTGATCCTGGCTCCAACCAGGGAGTTAGCGGTGCAGATTCAGAAGGGTCTGCTCGCGCTGGGGGATTACATGAACGTGCAGTGCCATGCCTGCATTGGGGGCACCAACGTCGGCGAGGACATCCGGAAGCTGGACTACGGACAGCACGTGGTGGCAGGCACGCCGGGACGCGTCTTTGATATGATCCGCCGGAGAAGTTTACGGACACGGGCTATCAAGATGCTGGTTTTGGATGAGGCTGATGAAATGTTGAACAAAGGTTTCAAGGAGCAGATCTATGATGTGTACAGGTACTTGCCACCAGCCACACAGGTCGTCCTCATCAGCGCCACACTGCCTCATGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCTTGGTGAAGCGTGATGAGTTGACTCTGGAAGGCATCAAACAGTTCTTTGTGGCTGTGGAAAGAGAGGAATGGAAATTTGATACTCTATGTGATCTCTATGACACGCTGACCATCACCCAGGCCGTCATCTTCTGCAACACCAAGCGGAAGGTTGACTGGCTGACAGAGAAAATGAGAGAAGCCAATTTCACTGTGTCGTCCATGCATGGAGACATGCCCCAGAAAGAACGAGAGTCTATCATGAAGGAGTTCCGGTCAGGTGCCAGCCGGGTGCTCATCTCCACAGACGTCTGGGCCCGGGGCCTGGATGTCCCTCAGGTGTCCCTCATCATTAACTACGACCTGCCCAACAACAGAGAACTGTACATTCACAGAATTGGGAGATCGGGTCGGTATGGACGAAAAGGTGTGGCCATCAATTTTGTGAAGAATGATGACATCCGGATTCTCAGGGACATTGAGCAGTACTACTCCACCCAGATAGACGAGATGCCCATGAATGTGGCTGACCTCATCTGAAGCTGGTGCTGGTGCACCGAGGCCCTGTTTGGAAACGGAAGCTTCTATTTAATGGGGTTGATATGGACTGTCTTCTCGGAGCCCCTCGGGAAGACCCTCAGCCTCCGCCATCTTTTCTAATGCACATGTACATAATCCGATGCTTAACCTTTTACATTAAACGTGGACATTTTCCTGTGA