Transcript asmbl_11318

Sequence
Transcript Sequence for observation asmbl_11318 of TGE0047152:
CTCGGTGCTAACTAAGGTTTGCACAGCAGCCATGAGCTACATCAATCTGCCCACCGTGCTGCCCAGCTCCCCCAGCAAGACTCGGGGGCAGATTCAGCACAGAGCTGATGAGAAGAGTCCGGCGCTTCCAGATCGCCCAGTACAAGTGCCTGGTCATCAAGTATGCCAAAGACACGCGCTATAGCAACAGCTTCTCCACACATGATCGGAACACCATGGACGCATTGCCAGCCTGCATGCTCCGCGATGTGACCCAGGAGTCCTTGGGTGTGGCCGTCATTGGCATCGATGAGGGGCAGTTTTTTCCTGACATTGTGGATTTCTGTGAAATGATGGCCAACGAGGGCAAGACAGTAATTGTGGCAGCGCTGGATGGGACCTTCCAGAGGAAGGCTTTCGGCAGCATCTTGAACCTGGTGCCCCTGGCGGAGAGTGTGGTGAAGCTCACCGCTGTGTGCATGGAGTGCTTCCGAGAAGCTGCCTACACGAAGAGGCTGGGCCTGGAGAAAGAGGTGGAGGTGATTGGCGGAGCCGACAAGTATCACTCCGTGTGCCGCCTGTGCTACTTTAAGAAGTCTTCAGCCCAGACTGCTGGCTCAGACAACAAGAACTGTCTGGTGCTGGGGCAGCCGGGAGAGGCCTTGGTTGTCAGGAAGCTCTTTGCCTCTCAGCAAGTCCTACAATACAACTCTGCCAACTGAGGGGACCTGAGGCCTGCCAGCTCCTACCCAGGTTGGACTCTCAGAGAGCAGGGGGAGCGCGGGCCTGCCATTCCTAATGGACAATGTACCTTGAACAGGCTGCCACTCGCTGAAGCCGTTTTCAGTTCCCTTCTTGATTGCCAAGATGCCTCAATGCAGACTGGAGCCCAGACCCTGCCTGGTGGCTAGCGGTCCCGTGTTCAGCCAAAGGTGAGGACAGAGCTGTCCAGCATTGTGACACTGGTGGGGCTAGTTTCTTCCTTGTTGGTGGCTGGGTTTCAGTCTCAGAGCCCCACCCTCACCAAGGCTCCAGGCCTCTCACAGCTCCCCCATTTATGCCTAAACATTCTCTCCTCAGAACCTCAGCTCTTAGTGAGCCACTTTTCTTGTGCAAAATGAACAATATTAAAGTTTACTACTAATGAGAACGTGTTTCTCCTTAGCCTGGGTTTCCC