Transcript asmbl_11231

Sequence
Transcript Sequence for observation asmbl_11231 of TGE0047134:
TCCCTCCACTTTGTCTACCTACATGTGCCCGCTGAGACCCAGTCCCATATTCACGACACCCCCAAGCCGTGGGGCCACCTCTCCTTGGCCAGCCCCCCACTGAGCAGCCTGCATCTTTAGCAGGGTGAGGAAGAGGATGAGAACGCTCGTCCCTTGGCTGAGTCCTTGCTCCTGGCCATTGCCGATTTGCTCTTCTGCCCAGACTTCACTGTGCAGAACCACCGGAGGAACGACGTGGACTCAGCAGAAGATGTCCATTCCCTGGACAGCTGTGAATATATCTGGGAGGCTGGTGTGGGCTTTGCTCATTCCCCACAGCCCAACTACATCCATGACATGAACCGGATGGAGCTGCTGAAGTTACTGCTCACGTGCTTCTCAGAGGCCATGTACCTGCCCCCATCTCCAGAGAGTGGCAGCACCAACCCCTGGGTTCAGTTCTTTTGTTCCACGGAGAACAGACACGCGCTGCCCCTCTTCACTTCACTCCTCAACACCGTGTGTGCCTATGACCCTGTGGGCTACGGGATCCCCTACAACCACCTGCTCTTCTCGGACTACCGGGAGCCCCTGGTGGAGGAGGCTGCTCAGGTGCTTATTGTCACCTTGGACCATGACAGTGCTACCAGCACCAGCCCCACCGTGGACGGCACCACCACGGGCACAGCTATGGATGATGCTGATCCTCCAGGGCCCGAGAACCTGTTTGTGAACTACCTGTCCCGAATTCATCGTGAGGAGGACTTCCAGTTCATCCTCAAGGGGATCGCTCGGCTGCTGTCCAATCCCCTGCTCCAGACCTACCTTCCCAACTCCACCAAGAAGATCCAGTTTCACCAGGAGTTGCTTGTTCTCTTCTGGAAACTCTGTGACTTCAACAAGAAATTCCTCTTCTTTGTACTGAAGAGCAGTGACGTGCTGGATATCCTGGTTCCTATCCTCTATTTTCTCAACGACGCCCGGGCAGATCAATCTCGGGTGGGCTTGATGCACATCGGGGTCTTCATCCTGCTGCTCCTGAGTGGGGAGAGGAACTTTGGGGTACGGCTGAACAAGCCCTACTCAGTGCGCGTGCCCATGGACATCCCGGTCTTCACAGGCACACATGCAGATTTGCTCATTGTGGTATTCCACAAAATCATCACCAGCGGTCATCAGCGGTTGCAACCCCTCTTCGACTGCCTGCTCACCATTGTGGTCAACGTGTCTCCCTACCTCAAGAGCCTGTCCATGGTGACTGCCAACAAGCTCCTGCATCTGCTCGAGGCCTTCTCGACCACCTGGTTCCTCTTCTCGGCATCTCAGAACCACCATCTGGTCTTCTTCCTTCTGGAGGTCTTCAACAACATTATCCAGTACCAGTTTGATGGCAATTCCAACCTGGTCTATGCCATCATCCGTAAACGTGCGGTCTTCCACCAGCTGGCCAACCTGCCCACTGACCCACCCTCCATCCACAAGGCACTTCAGCGGCGGCGGAGGACACCAGAGCCCCTGTCCCGTACTGGTTCCCAGGAGGGAACGTCCATGGAGGGATCCCGCCCTGCTGCCCCTGCAGAACCAGGCACCCTTAAGACTAGCCTGGTGGCCACTCCAGGCATCGACAAGCTGACAGAGAAATCCCAGGTATCAGAGGACGGCACCTTGAGGTCTCTAGAGCCCGAATCCCAGCAAAGCTCAGCAGAAAACAGCCCATCTGATGGGGAGTCCAGCCAAACATGGAGAGAGCAACGGAGATTGTCCAATGCATCAGCCAGTGGCCAGTGGAGCCCAACATCAGATTGGATCTTGTCCTGGAAGTCAAAGCTGCCGCTGCAGACCATCATGCGCCTGCTGCAGGTCCTGGTTCCCCAGGTGGAGAAGATCTGCATTGACAAGGGTCTGACGGATGAGTCTGAGATCCTGAGATTCCTGCAGCACGGTACCCTAGTGGGGCTTCTGCCTGTGCCCCACCCCATCCTTATCCGAAAGTACCAGGCGAACTCGGGGACTGCCATGTGGTTCCGTACCTACATGTGGGGCGTTATCTATTTGAGGAATGTGGACCCACCTATCTGGTATGACACTGACGTGAAGCTGTTTGAGATCCAGCGGGTGTGAGGATGTCGACTTGAGGGAATAGGGCCGGAAGAGCTGGTTCTAGTCCCCAGTGCTCCCAAACCCATTGTTCTGAGCTTAAAGATCCATTATCAGGGTGTGGGGCGAGCAGAGTAGTTGGTCCTGGATGGCAGGTCCCAGGTGCCCATTGTGGCTGGAGACACAGGGATTTAAAAAAAAAAGTGCCCCTCTGCCCTCCAGGCTGTTCTAGGAGCCTCTTGTCTCCTCCAGAGATACAACCCCATCAGAACCCCTGCCCACTCTGGCTCCTCCTCCAAGACCTGCCCTTGTGCTGCCTGCTCCCAGAAGCTGTCAGGTCACTGTGCCCTAATGGGTTGTCTCAAAAAGGAGCCATGTGCTGCCCCGTGAGGGCACCTGGTCATGGTAAAGGGAGTTCTGGCTACCTAGTCTGAGACTTCTGTTCCAGGCGTCCCTTTTGCCAGCGCCCTGGTTGGGAAGAGCGACTCAGCCGCTAGTGAAGAAGGCTGGAGGCTGACGCTTGTGAAGCAGGACCGTGGAGTGTGCTTTAGGGGCTTGGAGTAGGGTATCGAGAGTGCCCTGTTACTGTCCGGGGTCGGGGGAATCTGCCTGGCTGGTGGAGCCTGAAGGATGTCGGTGTCCCTGCCTTATCTGCGGCCTGGGTGGTGGGAGTTACACTCTATGAGCCCCAGCTCTGGCCTCCCGGTCGCCCTTGCCTCCCCTGTGTCAGTACAATCTTTGCTCTGTACAATCGGCCACTTTACACAATAAAATGTCCCTCCCAGT