Transcript asmbl_11230

Sequence
Transcript Sequence for observation asmbl_11230 of TGE0047133:
GCTGGAGCTGGAGTCACAGCCGGAGCCCGCGGCAGAGTCGGAATCCGGGGTCGGGCTGGAGCGGGGTCCATCGACATGGGATCCGCAGACTCCAAGCTGAACTTCCGGAAGGCGGTGATCCAGCTGACCACCAAGACGCAGGCTGTGGAGAAGCTGGTGCAAGGAGCAGAGGGTGGCTGCCACTCTGAGAAGGAGAAACAGGTCGTCCTGAACTGCAGCCGGCTACTCACCCGAGTGCTGCCTTACATCTTCGAGGACCCCGACTGGAGGGGCTTCTTCTGGTCCACAGTGCCCGGGGCAGGGCGTGGAGGGGGTGAGGAAGAGGATGAGAACGCTCGTCCCTTGGCTGAGTCCTTGCTCCTGGCCATTGCCGATTTGCTCTTCTGCCCAGACTTCACTGTGCAGAACCACCGGAGGAACGACGTGGACTCAGCAGAAGATGTCCATTCCCTGGACAGCTGTGAATATATCTGGGAGGCTGGTGTGGGCTTTGCTCATTCCCCACAGCCCAACTACATCCATGACATGAACCGGATGGAGCTGCTGAAGTTACTGCTCACGTGCTTCTCAGAGGCCATGTACCTGCCCCCATCTCCAGAGAGTGGCAGCACCAACCCCTGGGTTCAGTTCTTTTGTTCCACGGAGAACAGACACGCGCTGCCCCTCTTCACTTCACTCCTCAACACCGTGTGTGCCTATGACCCTGTGGGCTACGGGATCCCCTACAACCACCTGCTCTTCTCGGACTACCGGGAGCCCCTGGTGGAGGAGGCTGCTCAGGTGCTTATTGTCACCTTGGACCATGACAGTGCTACCAGCACCAGCCCCACCGTGGACGGCACCACCACGGGCACAGCTATGGATGATGCTGATCCTCCAGGGCCCGAGAACCTGTTTGTGAACTACCTGTCCCGAATTCATCGTGAGGAGGACTTCCAGTTCATCCTCAAGGGGATCGCTCGGCTGCTGTCCAATCCCCTGCTCCAGACCTACCTTCCCAACTCCACCAAGAAGATCCAGTTTCACCAGGAGTTGCTTGTTCTCTTCTGGAAACTCTGTGACTTCAACAAGAAATTCCTCTTCTTTGTACTGAAGAGCAGTGACGTGCTGGATATCCTGGTTCCTATCCTCTATTTTCTCAACGACGCCCGGGCAGATCAATCTCGGGTGGGCTTGATGCACATCGGGGTCTTCATCCTGCTGCTCCTGAGTGGGGAGAGGAACTTTGGGGTACGGCTGAACAAGCCCTACTCAGTGCGCGTGCCCATGGACATCCCGGTCTTCACAGGCACACATGCAGATTTGCTCATTGTGGTATTCCACAAAATCATCACCAGCGGTCATCAGCGGTTGCAACCCCTCTTCGACTGCCTGCTCACCATTGTGGTCAACGTGTCTCCCTACCTCAAGAGCCTGTCCATGGTGACTGCCAACAAGCTCCTGCATCTGCTCGAGGCCTTCTCGACCACCTGGTTCCTCTTCTCGGCATCTCAGAACCACCATCTGGTCTTCTTCCTTCTGGAGGTCTTCAACAACATTATCCAGTACCAGTTTGATGGCAATTCCAACCTGGTCTATGCCATCATCCGTAAACGTGCGGTCTTCCACCAGCTGGCCAACCTGCCCACTGACCCACCCTCCATCCACAAGGCACTTCAGCGGCGGCGGAGGACACCAGAGCCCCTGTCCCGTACTGGTTCCCAGGAGGGAACGTCCATGGAGGGATCCCGCCCTGCTGCCCCTGCAGAACCAGGCACCCTTAAGACTAGCCTGGTGGCCACTCCAGGCATCGACAAGCTGACAGAGAAATCCCAGGTATCAGAGGACGGCACCTTGAGGTCTCTAGAGCCCGAATCCCAGCAAAGCTCAGCAGAAAACAGCCCATCTGATGGGGAGTCCAGCCAAACATGGAGAGAGCAACGGAGATTGTCCAATGCATCAGCCAGTGGCCAGTGGAGCCCAACATCAGATTGGATCTTGTCCTGGAAGTCAAAGCTGCCGCTGCAGACCATCATGCGCCTGCTGCAGGTCCTGGTTCCCCAGGTGGAGAAGATCTGCATTGACAAGGGTCTGACGGATGAGTCTGAGATCCTGAGATTCCTGCAGCACGGTACCCTAGTGGGGCTTCTGCCTGTGCCCCACCCCATCCTTATCCGAAAGTACCAGGCGAACTCGGGGACTGCCATGTGGTTCCGTACCTACATGTGGGGCGTTATCTATTTGAGGAATGTGGACCCACCTATCTGGTATGACACTGACGTGAAGCTGTTTGAGATCCAGCGGGTGTGAGGATGTCGACTTGAGGGAATAGGGCCGGAAGAGCTGGTTCTAGTCCCCAGTGCTCCCAAACCCATTGTTCTGAGCTTAAAGATCCATTATCAGGGTGTGGGGCGAGCAGAGTAGTTGGTCCTGGATGGCAGGTCCCAGGTGCCCATTGTGGCTGGAGACACAGGGATTTAAAAAAAAAAGTGCCCCTCTGCCCTCCAGGCTGTTCTAGGAGCCTCTTGTCTCCTCCAGAGATACAACCCCATCAGAACCCCTGCCCACTCTGGCTCCTCCTCCAAGACCTGCCCTTGTGCTGCCTGCTCCCAGAAGCTGTCAGGTCACTGTGCCCTAATGGGTTGTCTCAAAAAGGAGCCATGTGCTGCCCCGTGAGGGCACCTGGTCATGGTAAAGGGAGTTCTGGCTACCTAGTCTGAGACTTCTGTTCCAGGCGTCCCTTTTGCCAGCGCCCTGGTTGGGAAGAGCGACTCAGCCGCTAGTGAAGAAGGCTGGAGGCTGACGCTTGTGAAGCAGGACCGTGGAGTGTGCTTTAGGGGCTTGGAGTAGGGTATCGAGAGTGCCCTGTTACTGTCCGGGGTCGGGGGAATCTGCCTGGCTGGTGGAGCCTGAAGGATGTCGGTGTCCCTGCCTTATCTGCGGCCTGGGTGGTGGGAGTTACACTCTATGAGCCCCAGCTCTGGCCTCCCGGTCGCCCTTGCCTCCCCTGTGTCAGTACAATCTTTGCTCTGTACAATCGGCCACTTTACACAATAAAATGTCCCTCCCAGT