Transcript asmbl_11228

Sequence
Transcript Sequence for observation asmbl_11228 of TGE0047131:
GCTGGAGCTGGAGTCACAGCCGGAGCCCGCGGCAGAGTCGGAATCCGGGGTCGGGCTGGAGCGGGGTCCATCGACATGGGATCCGCAGACTCCAAGCTGAACTTCCGGAAGGCGGTGATCCAGCTGACCACCAAGACGCAGCCCGTGGAAGCCACCGACAATGCTTTCTGGGACCAGTTCTGGGCAGACACCGCTACCTCGGTGCAGGATGTCTTTGCGTTGGTGCCGGCAGCAGAGATCCGGGCTGTGCGAGAGGAGTCACCCTCTAACCTGGCCACGCTGTGCTACAAGGCTGTGGAGAAGCTGGTGCAAGGAGCAGAGGGTGGCTGCCACTCTGAGAAGGAGAAACAGGTCGTCCTGAACTGCAGCCGGCTACTCACCCGAGTGCTGCCTTACATCTTCGAGGACCCCGACTGGAGGGGCTTCTTCTGGTCCACAGTGCCCGGGGCAGGGCGTGGAGGGGGTGAGGAAGAGGATGAGAACGCTCGTCCCTTGGCTGAGTCCTTGCTCCTGGCCATTGCCGATTTGCTCTTCTGCCCAGACTTCACTGTGCAGAACCACCGGAGGAACGACGTGGACTCAGCAGAAGATGTCCATTCCCTGGACAGCTGTGAATATATCTGGGAGGCTGGTGTGGGCTTTGCTCATTCCCCACAGCCCAACTACATCCATGACATGAACCGGATGGAGCTGCTGAAGTTACTGCTCACGTGCTTCTCAGAGGCCATGTACCTGCCCCCATCTCCAGAGAGTGGCAGCACCAACCCCTGGGTTCAGTTCTTTTGTTCCACGGAGAACAGACACGCGCTGCCCCTCTTCACTTCACTCCTCAACACCGTGTGTGCCTATGACCCTGTGGGCTACGGGATCCCCTACAACCACCTGCTCTTCTCGGACTACCGGGAGCCCCTGGTGGAGGAGGCTGCTCAGGTGCTTATTGTCACCTTGGACCATGACAGTGCTACCAGCACCAGCCCCACCGTGGACGGCACCACCACGGGCACAGCTATGGATGATGCTGATCCTCCAGGGCCCGAGAACCTGTTTGTGAACTACCTGTCCCGAATTCATCGTGAGGAGGACTTCCAGTTCATCCTCAAGGGGATCGCTCGGCTGCTGTCCAATCCCCTGCTCCAGACCTACCTTCCCAACTCCACCAAGAAGATCCAGTTTCACCAGGAGTTGCTTGTTCTCTTCTGGAAACTCTGTGACTTCAACAAGAAATTCCTCTTCTTTGTACTGAAGAGCAGTGACGTGCTGGATATCCTGGTTCCTATCCTCTATTTTCTCAACGACGCCCGGGCAGATCAATCTCGGGTGGGCTTGATGCACATCGGGGTCTTCATCCTGCTGCTCCTGAGTGGGGAGAGGAACTTTGGGGTACGGCTGAACAAGCCCTACTCAGTGCGCGTGCCCATGGACATCCCGGTCTTCACAGGCACACATGCAGATTTGCTCATTGTGGTATTCCACAAAATCATCACCAGCGGTCATCAGCGGTTGCAACCCCTCTTCGACTGCCTGCTCACCATTGTGGTCAACGTGTCTCCCTACCTCAAGAGCCTGTCCATGGTGACTGCCAACAAGCTCCTGCATCTGCTCGAGGCCTTCTCGACCACCTGGTTCCTCTTCTCGGCATCTCAGAACCACCATCTGGTCTTCTTCCTTCTGGAGGTCTTCAACAACATTATCCAGTACCAGTTTGATGGCAATTCCAACCTGGTCTATGCCATCATCCGTAAACGTGCGGTCTTCCACCAGCTGGCCAACCTGCCCACTGACCCACCCTCCATCCACAAGGCACTTCAGCGGCGGCGGAGGACACCAGAGCCCCTGTCCCGTACTGGTTCCCAGGAGGGAACGTCCATGGAGGGATCCCGCCCTGCTGCCCCTGCAGAACCAGGCACCCTTAAGACTAGCCTGGTGGCCACTCCAGGCATCGACAAGCTGACAGAGAAATCCCAGGTATCAGAGGACGGCACCTTGAGGTCTCTAGAGCCCGAATCCCAGCAAAGCTCAGCAGAAAACAGCCCATCTGATGGGGAGTCCAGCCAAACATGGAGAGAGCAACGGAGATTGTCCAATGCATCAGCCAGTGGCCAGTGGAGCCCAACATCAGATTGGATCTTGTCCTGGAAGTCAAAGCTGCCGCTGCAGACCATCATGCGCCTGCTGCAGGTCCTGGTTCCCCAGGTGGAGAAGATCTGCATTGACAAGGGTCTGACGGATGAGTCTGAGATCCTGAGATTCCTGCAGCACGGTACCCTAGTGGGGCTTCTGCCTGTGCCCCACCCCATCCTTATCCGAAAGTACCAGGCGAACTCGGGGACTGCCATGTGGTTCCGTACCTACATGTGGGGCGTTATCTATTTGAGGAATGTGGACCCACCTATCTGGTATGACACTGACGTGAAGCTGTTTGAGATCCAGCGGGTGTGAGGATGTCGACTTGAGGGAATAGGGCCGGAAGAGCTGGTTCTAGTCCCCAGTGCTCCCAAACCCATTGTTCTGAGCTTAAAGATCCATTATCAGGGTGTGGGGCGAGCAGAGTAGTTGGTCCTGGATGGCAGGTCCCAGGTGCCCATTGTGGCTGGAGACACAGGGATTTAAAAAAAAAAGTGCCCCTCTGCCCTCCAGGCTGTTCTAGGAGCCTCTTGTCTCCTCCAGAGATACAACCCCATCAGAACCCCTGCCCACTCTGGCTCCTCCTCCAAGACCTGCCCTTGTGCTGCCTGCTCCCAGAAGCTGTCAGGTCACTGTGCCCTAATGGGTTGTCTCAAAAAGGAGCCATGTGCTGCCCCGTGAGGGCACCTGGTCATGGTAAAGGGAGTTCTGGCTACCTAGTCTGAGACTTCTGTTCCAGGCGTCCCTTTTGCCAGCGCCCTGGTTGGGAAGAGCGACTCAGCCGCTAGTGAAGAAGGCTGGAGGCTGACGCTTGTGAAGCAGGACCGTGGAGTGTGCTTTAGGGGCTTGGAGTAGGGTATCGAGAGTGCCCTGTTACTGTCCGGGGTCGGGGGAATCTGCCTGGCTGGTGGAGCCTGAAGGATGTCGGTGTCCCTGCCTTATCTGCGGCCTGGGTGGTGGGAGTTACACTCTATGAGCCCCAGCTCTGGCCTCCCGGTCGCCCTTGCCTCCCCTGTGTCAGTACAATCTTTGCTCTGTACAATCGGCCACTTTACACAATAAAATGTCCCTCCCAGT