Transcript asmbl_11186

Sequence
Transcript Sequence for observation asmbl_11186 of TGE0047126:
ACCTCATTCATTTCCATCGGTCCTTGCCCTCGCAGCTCCGGCCCTCGACACCACCGGCCCCTCCGCTGGTGACGCCCCCGCAGAGGCTTCGCCGTCGCCGAGGCCTTCTCTCCGCGACTCGTCGCCGCAGGATTCTACTTTCACTGGGTTCCGCCCGCACACCGCCACCATTGACGCCATGTCGAGTTATTCTAGTGACCGAGACCGCGGCCGGGATCGAGGGTTTGGTGCACCTCGATTTGGAGGGAGTAGAACAGGACCCCTCTCTGGAAAGAAGTTTGGAAATCCTGGGGAGAAACTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCCAAATTTGAGAAGAATTTTTATCAAGAACACCCTGATTTGGCAAGGCGCACCGCACAAGAGGTAGATACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGTCCAAAACCTGTTCTGAATTTTTATGAAGCAAACTTTCCTGCGAATGTCATGGATGTGATTGCAAGGCAGAACTTTACTGAACCCACTGCTATTCAAGCTCAGGGCTGGCCAGTTGCTCTCAGTGGATTGGATATGGTTGGAGTAGCTCAGACTGGATCTGGGAAAACATTATCTTATTTGCTGCCTGCCATTGTACACATAAACCACCAGCCATTCCTAGAGAGAGGTGATGGGCCTATTTGCTTGGTGCTGGCACCAACTCGAGAACTGGCACAGCAGGTGCAGCAAGTGGCTGCTGAATATTGTCGAGCTTGTCGCTTGAAGTCTACTTGCATCTATGGTGGTGCTCCCAAAGGACCACAGATTCGTGATTTGGAAAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGGAAAACCAATCTGAGAAGAACAACTTACCTTGTCCTTGATGAAGCTGATAGGATGCTTGATATGGGATTTGAACCCCAGATAAGGAAAATTGTGGATCAAATAAGACCTGATAGGCAAACACTAATGTGGAGTGCAACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATCAATATTGGTGCACTGGAACTGAGTGCAAACCATAACATTCTTCAGATTGTGGATGTATGTCATGATGTCGAAAAGGATGAAAAGCTTATTCGTCTGATGGAAGAAATCATGAGTGAGAAGGAGAATAAAACTATTGTTTTTGTTGAAACCAAAAGAAGATGTGATGAACTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGCATCCATGGTGACAAGAGTCAGCAGGAACGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACCGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGGGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGACGATCGTCGTGACAGATACTCTGCAGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAACTATGACAGAGGCTACTCTAATCTGCTTAAGAGAGATTTTGGGGCTAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTATCTGCTGGCATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAACGGTTATGATAGCACTCAGCAATATGGAAGTAATGTTGCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACCGCAGCTGCTGCGCCTATGATTGGCTATCCCATGCCAACAGGGTATTCTCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCAGACAAGATAGTTATTTAAGAAACATGGGAAATGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAACTGTACAGTGATTTCAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAGATATTTGAAGACTGAATTAAGTGAAATTGTACTTTATTTTACATATATAATGTCATGTACAACTTGGCTTAGATAGTGTTTTTGGGGGGGATTTTTGTTTTGGTGTTTATTTTTACACAAGGAAAGTTGACTACTTCCCATTCCTGGATTTAGGAGAGGAACTCAGAAGGCCCTTAGGATGATCTGTTTGTATGGGAAGAAGTTAGAGACAATGGATTTTATAATTCCAGATTTATTGGATAAAAGCTTTGTCATTTTTCAGTATCAGGGAAGTAAGTCATTTAATAGCCTATTTTCCTTAAGAGTGAACTACAGGACAGTAACTATATAAATACATGTTGATTTCTTTTGCAAAACAGTTTTAAGTAATGACATTTTTGCTTTATCAAAATTTTATTCCATCTCTTGGTTTTGTTGTCAACTGCCGAAATGTGCGAAGCTGAAAGACTGTTAGCCCAAGAGCTGTGTGCACTGTGTCTTTAGTGCAGGATTACCTTGTAGGTTCCTAGTCCTCGAGGACTTGCCAGAGTGCTTATAGCCACACCTGGAAGTCAGGAATGTCTCCACATTATTTCAGGGGATTTTAGGGGTCTTGTAGGCTAGTCACAAGGAAGACGACATAACCAAAAGCACAGTAAAGTTTTCGGGTTAGGTTCACTATGGGCTTAACAGCTAGAAGGATTGGGGGGAAAGCTTTAGATTTAAGTAGGATCACCAGCAAACAGCTTTGTTTCAGAATGGCTATAAGTAGGTCTAAATGTCTTCCCAAAAAATTGGTGTGTTTTTTGCCCAGGACAAAAGTCTTAAAGGAAGTTATTTAACTTTTTGTTTTTAAAATGGGCTTATTGTTAATGCCTTATTTATAAAATGTTAAAACAAAATAGAATGTGCTGGGGGTGGGAGCTGGGCGTGTTTTCCAGGGCTGATAACATTGAAAACTGGTTCATCCTCTAGTACTGAGTGGTTTTCAATGGCATGGCTAGTCAGATTCATGATTTTTAAGTATAGGTGTAGATTGGAGCATTTATTACATATTTTACTGTTCAATGTCTTAATGTGGACCTTTTATTTTGTAAATAATTATGGAAATGATTGTGGGGCTTGGAAAAAATTACCTTTGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTTGTCTTAACTAATAAATGTGATTTTTCTCCCCA