Transcript asmbl_11071

Sequence
Transcript Sequence for observation asmbl_11071 of TGE0047118:
GAGGCGGGGCAGAGCTGAAGATCCGGATCCGGAGCGGCTGAAAGGCGGAAGTGGAGGCCGGAGCCTGGGACACCGCCGGGGGTGGGGGGGAGAGGAGCGGAGTCTGTGGAAGCCCCGGCCCAAAGTAACGCTGCTGCCCGGAGCCGCGACTGATTTCCTGAATTGGAGGCCTCCCTTCCCATTAAGTGCCTCTTTGCATAGCACCGGCCCCACCCCCACGCTCACTGGTACTACTACAGAGCAGCGCGCCATGGCGGGTCGAGGAGGTGCAGCACGACCCAATGGACCAGCTGCTGGCAACAAGATCTGTCAGTTTAAGCTGGTCCTCTTGGGCGAGTCTGCCGTGGGCAAGTCCAGCCTGGTCCTCCGCTTTGTCAAGGGGCAGTTCCATGAGTACCAGGAGAGCACAATTGGAGCGGCTTTCCTCACACAGACTGTCTGCTTAGACGATACAACGGTCAAGTTTGAGATCTGGGACACAGCTGGCCAAGAGCGCTATCACAGCCTGGCCCCGATGTACTATCGGGGGGCCCAAGCAGCCATTGTGGTCTATGACATCACCAACACAGATACATTTGCACGGGCTAAGAATTGGGTGAAGGAGTTACAGAGGCAGGCCAGCCCCAACATCGTCATTGCACTAGCGGGGAACAAAGCAGACCTGGCCAGCAAGAGAGCTGTGGAGTTTCAGGAAGCACAAGCCTATGCAGATGACAACAGCTTGCTCTTCATGGAGACGTCTGCCAAGACTGCAATGAACGTGAATGAAATTTTCATGGCAATAGCTAAGAAGCTTCCCAAGAATGAGCCCCAGAATGCGGCTGGGGCTCCGGGCCGAACCAGAGGTGTGGATCTGCAGGAGAGCAACCCAGCCAGCCGGAGCCAGTGCTGCAGCAACTGAGCCCCCTTACCTGCCACTGCCCCCACTCCTCCACCACAATGACCCGACTGGAATCTACTCTAACCAATCGCACTTAACAACTCGGGCCACCACTGGGGGCAGGGGAAGGGTCCATCAAGAATTCTCCGCATAACTTTGATCCTAGGCCGGAGGGAGTTATTCCACCTGCACCTTTCTGTACAAATACTAATTCAATTTTAAGTCTTAAGTCACTTTTTTAATATATATGATCTTCTGCTCTTCCCAGGTCCCTTTCTCCCGCTCCCCCACTTGCCCTTTGCTGGTAGTAGCCATGCTCCTGTGCTCCTCATCCGTGGGGACAGGGCTTGGAGCAGTCACCCTTTCTTCCCTTCTTGCTGGAGAGCGGACTCAGCAAGAGCACCCACATCTTAACTTGTTGGGAGCGTCTTAGGCTGGGGCAGTGGGCAGGCCCTGAGCTGGGGAAGGGACAGGCTGCTCTTCCCTCAGCTGGCTGTCAATCAGGCTGCAGCCTCCTCCCCAACTGACTCCCAGCTGGGAGAGAAACCGCAGCATTACTTAAGCATCATTATTGACAGCCGGACACCCATGGCCCAGGATCCCTCCACCCTTGGTCACTCTGACCTCTGGCTCTGAGCCCTGTTCTGACCAAATCACGATGATGAGTATTTGGGGGTGGGTGGGTAAGGGGG