Transcript asmbl_10972

Sequence
Transcript Sequence for observation asmbl_10972 of TGE0039097:
TGGCAATTAAATCCTGCTCCTCTAGAAGAGCTCCCAGTACTCTAAACCGCTGAGCCATCTCTCCAACGCCCTGGATCTCCGCCCTGGATCTCGTCTTTGAACTAAAGGAGTCGGAAAATACAGATCCGCAATATTCCACCTCAGCTCCGATGGGAAGTGCTAGATAGCCTGCTGGCTCAGTACGGTACAGTGGAGAACTGTGAGCAAGTGAACACTGAAAGTGAGACAGCTGTGGTCAACGTCACCTACTCTAACCGGGAGCAGACCAGGCAAGCTATCATGAAGCTAAATGGCCATCAACTGGAGAACCATGCCCTGAAGGTCTCCTACATACCTGATGAGCAGATAACGCAAGGTCCTGAGAATGGGCGTCGTGGAGGCTTTGGGTCTCGGGGCCAGCCCCGGCAAGGGTCGCCCGTGGCAGCAGGGGCTCCAGCCAAGCAGCAGCCAGTGGACATCCCTCTCCGGCTCCTGGTGCCTACGCAGTATGTAGGCGCTATCATTGGCAAGGAGGGTGCCACCATCCGAAACATCACAAAACAGACGCAGTCCAAAATAGACGTGCATAGGAAGGAGAATGCGGGCGCTGCGGAGAAGGCCATCAGCGTGCATTCAACCCCTGAAGGCTGCTCCTCCGCGTGCAAGATGATCTTGGAGATTATGCACAAGGAGGCAAAGGACACCAAAACGGCAGATGAAGTTCCCCTGAAGATCCTGGCTCATAACAACTTCGTCGGGCGACTCATTGGCAAGGAAGGGCGGAACCTGAAGAAGGTGGAGCAGGACACAGAGACGAAGATCACCATCTCATCGCTCCAGGACCTCACGCTCTATAACCCTGAGAGGACCATCACTGTGAAGGGCGCCATTGAGAACTGTTGCAGGGCCGAGCAGGAGATCATGAAGAAAGTTCGAGAGGCTTACGAGAACGACGTGGCCGCCATGAGCTTGCAGTCCCACCTCATCCCTGGGCTTAACCTGGCTGCTGTAGGTCTCTTCCCAGCTTCATCCAGCGCTGTCCCTCCTCCTCCCAGCAGTGTCACCGGGGCTGCTCCCTATAGCTCCTTCATGCAGGCTCCGGAGCAGGAGATGGTACAAGTGTTCATCCCCGCCCAGGCTGTGGGCGCCATCATTGGCAAGAAGGGCCAGCACATCAAACAACTCTCCCGCTTCGCCAGCGCCTCCATCAAGATTGCACCACCAGAAACACCTGACTCCAAAGTTCGAATGGTCGTCATCACTGGACCCCCAGAGGCTCAGTTCAAGG