Transcript asmbl_10971

Sequence
Transcript Sequence for observation asmbl_10971 of TGE0039097:
ATTCCAGCCAATCTGCCTGCCATTGCTTTCTGGATATGGATTAACAAACATCCTTGCAGAGATTAGATTTCACTGCTACCACCCTGCTCCTGCCATACTGAATAGAAGGCCCCAAATCAGAGTTTGGACAGGAGTCGGAAAATACAGATCCGCAATATTCCACCTCAGCTCCGATGGGAAGTGCTAGATAGCCTGCTGGCTCAGTACGGTACAGTGGAGAACTGTGAGCAAGTGAACACTGAAAGTGAGACAGCTGTGGTCAACGTCACCTACTCTAACCGGGAGCAGACCAGGCAAGCTATCATGAAGCTAAATGGCCATCAACTGGAGAACCATGCCCTGAAGGTCTCCTACATACCTGATGAGCAGATAACGCAAGGTCCTGAGAATGGGCGTCGTGGAGGCTTTGGGTCTCGGGGCCAGCCCCGGCAAGGGTCGCCCGTGGCAGCAGGGGCTCCAGCCAAGCAGCAGCCAGTGGACATCCCTCTCCGGCTCCTGGTGCCTACGCAGTATGTAGGCGCTATCATTGGCAAGGAGGGTGCCACCATCCGAAACATCACAAAACAGACGCAGTCCAAAATAGACGTGCATAGGAAGGAGAATGCGGGCGCTGCGGAGAAGGCCATCAGCGTGCATTCAACCCCTGAAGGCTGCTCCTCCGCGTGCAAGATGATCTTGGAGATTATGCACAAGGAGGCAAAGGACACCAAAACGGCAGATGAAGTTCCCCTGAAGATCCTGGCTCATAACAACTTCGTCGGGCGACTCATTGGCAAGGAAGGGCGGAACCTGAAGAAGGTGGAGCAGGACACAGAGACGAAGATCACCATCTCATCGCTCCAGGACCTCACGCTCTATAACCCTGAGAGGACCATCACTGTGAAGGGCGCCATTGAGAACTGTTGCAGGGCCGAGCAGGAGATCATGAAGAAAGTTCGAGAGGCTTACGAGAACGACGTGGCCGCCATGAGCTTGCAGTCCCACCTCATCCCTGGGCTTAACCTGGCTGCTGTAGGTCTCTTCCCAGCTTCATCCAGCGCTGTCCCTCCTCCTCCCAGCAGTGTCACCGGGGCTGCTCCCTATAGCTCCTTCATGCAGGCTCCGGAGCAGGAGATGGTACAAGTGTTCATCCCCGCCCAGGCTGTGGGCGCCATCATTGGCAAGAAGGGCCAGCACATCAAACAACTCTCCCGCTTCGCCAGCGCCTCCATCAAGATTGCACCACCAGAAACACCTGACTCCAAAGTTCGAATGGTCGTCATCACTGGACCCCCAGAGGCTCAGTTCAAGG