Transcript asmbl_8472

Sequence
Transcript Sequence for observation asmbl_8472 of TGE0044544:
GGCTGGTGGGGGCAGGGCCTCAGGGAGGGAAGCAGCTCTCCAGCTGCCTTTATAGGTTTCATAAGTCTTAAGCATCAGCAGCTCATTCTTTAGATGGCAGGGGAAGCAGGCTTGGAGCAGATTGGCTCCTGGCCTGATCAGAGTTGACTGGCACCCACATGTAAGTGGTACGGGCTGTAGGCTTGTTGGCTCTGGATTAATGGAGGGAGGCTGAGTCTGAACCACTAGCCCACGACGGTGTGTGCATCTGCAGAGTGCCCACCTATTGGGATGGAGTCACACCGCATTGAGGACAACCAGATCCGTGCCTCCTCCATGCTGCGCCACGGCCTCGGAGCCCAGCGGGGCCGGCTCAACATGCAGGCTGGTGCCAATGAAGATGACTACTATGACGGGGCATGGTGTGCTGAGGACGAGTCGCAGACCCAGTGGATCGAGGTGGACACCCGAAGGACAACTCGGTTCACGGGCGTCATCACTCAGGGCCGTGACTCCAGCATCCATGACGACTTCGTGACTACCTTCTTTGTGGGCTTCAGCAATGACAGCCAGACCTGGGTGATGTACACCAATGGCTACGAGGAAATGACCTTCTATGGAAATGTGGACAAGGACACACCTGTGCTGAGCGAGCTCCCTGAGCCAGTTGTGGCCCGTTTCATCCGCATCTATCCACTCACCTGGAACGGTAGCCTGTGCATGCGCCTGGAGGTGCTAGGCTGCCCCGTGACCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTAACTACTGACAGCCTGGACTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTGATGAAGGCTGTCAATGAGGAGTGCCCCACAATCACTCGCACATACAGCCTGGGCAAGAGTTCACGAGGGCTCAAGATCTACGCAATGGAAATCTCAGACAACCCTGGGGATCATGAACTGGGGGAGCCCGAGTTCCGCTACACAGCCGGGATCCACGGCAATGAGGTGCTAGGCCGAGAGCTCCTGCTCCTGCTCATGCAATACCTATGCCAGGAGTACCGCGATGGGAACCCGAGAGTGCGCAACCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCGCTGAACCCTGATGGCTATGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCACTGGGGCTGTGGACTGAGGAGGGCTTTGACATCTTCGAGGACTTCCCAGATCTCAACTCTGTGCTCTGGGCAGCTGAGGAGAAGAAATGGGTCCCCTACAGGGTCCCAAACAATAACTTGCCAATCCCTGAACGTTACCTGTCCCCAGATGCCACGGTCTCCACAGAAGTCCGGGCCATTATTTCCTGGATGGAGAAGAACCCCTTTGTGCTGGGTGCAAATCTGAACGGTGGTGAGCGGCTTGTGTCTTATCCCTATGACATGGCCCGGACACCTAGCCAGGAGCAGCTGTTGGCCGAGGCACTGGCAGCTGCCCGCGGAGAAGATGATGACGGGGTGTCTGAGGCCCAGGAGACTCCAGATCACGCTATTTTCCGCTGGCTGGCCATCTCATTTGCCTCCGCCCATCTCACCATGACGGAGCCCTACCGGGGAGGGTGCCAGGCCCAGGACTACACCAGCGGCATGGGCATTGTCAACGGGGCCAAGTGGAATCCTCGCTCTGGGACTTTCAATGACTTTAGCTACCTGCACACAAACTGTCTGGAGCTCTCCGTATACCTGGGCTGTGACAAGTTCCCCCACGAGAGTGAGCTACCCCGAGAATGGGAGAACAACAAAGAAGCGCTGCTCACCTTCATGGAGCAGGTGCACCGTGGCATTAAGGGTGTGGTGACAGATGAGCAAGGCATCCCCATTGCCAATGCCACCATCTCTGTGAGTGGCATCAACCATGGTGTGAAGACAGCAAGTGGAGGTGACTACTGGCGCATTCTGAACCCGGGTGAGTACCGTGTGACAGCTCACGCAGAGGGCTACACCTCAAGTGCCAAGATCTGCAATGTGGACTACGATATTGGGGCCACTCAGTGCAACTTCATCCTGGCTCGATCCAACTGGAAGCGCATTCGGGAGATCTTGGCTATGAACGGGAACCGTCCCATTCTCCGAGTTGACCCCTCACGACCCATGACCCCCCAGCAGCGGCGCATGCAGCAGCGCCGTCTACAGTACCGGCTCCGCATGAGGGAACAGATGCGACTGCGTCGCCTCAATTCTACCGCAGGCCCTGCCACAAGCCCCACTCCTGCCCTTATGCCTCCCCCTTCCCCTACACCAGCCATTACCTTGAGGCCCTGGGAAGTTCTACCCACTACCACTGCAGGCTGGGAGGAGTCAGAGACTGAGACCTATACAGAAGTAGTGACAGAGTTTGAGACAGAGTATGGGACTGACCTAGAGGTGGAAGAGATAGAGGAGGAGGAGGAGGAGGAG