Transcript asmbl_8330

Sequence
Transcript Sequence for observation asmbl_8330 of TGE0041829:
CACAGTCCACAAAGGCTTTTTATTTATGCTTTACATTTAAAAAAAGAATCCCAGGATTTTCCCTCCTGTATGTTTTCGTCTTGCCTCTTCATGGTCCATAATGCCAGCCGAGGTTGTCAGCACAATGAGGCCAAACTGACGTGAAGGGAGCAGGTTGTTCTGCCATTTCTCTAGGTCTTTGAGTTGAACATCAAATCTAGGGCTTATAACGCCACACTTGTTCAACCTTCCTGTGAGGTTCACAACAATCTTCCCAGCTCTGTGACCATCAATGATCTCGAATTCACCAATGTATCCGTGCTTCATCATCACAGTTAAGAACCGAACGATGACTTTAGAACATGGCCTGATGAGGACCTGGCGTTTGCCTCTCTTCTCAGCGTTGTTGATGCTCTTGAGAGCATCCGCCAGAACATTCATTCACACCATGGTGGCGGCGAAGGAAGATGGCAGAAAG