Transcript asmbl_722

Sequence
Transcript Sequence for observation asmbl_722 of TGE0003178:
GTGTTCGCAGCCTTCGCCGCGCCGCTGCCGCTCTCCAACGCCAGCGCCGCCTCTCGCTTGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTGTCCTTACCATGGCTCGTACAAAGCAGACTGCCCGCAAATCCACCGGTGGTAAAGCACCCAGGAAACAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCCCTCCGTGAAATCAGACGCTATCAGAAGTCCACTGAACTTCTGATCCGCAAGCTCCCCTTTCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTATTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGATACCAATCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGATATCCAGCTAGCACGCCGCATACGCGGAGAACGTGCTTAAGAGTCCACTATGAGGGGAAACATTTCATTCTCAAAAAAATTTTTTTTCCTCTTCTTCCTGTTATCAGTAGTTCTGAATGTTAGATATTTTTTCCATGGGGTCAAAGGTACCTAAGTATATGATTGCGAGTGGAAACATAGGGGACAGAATCAGGTATTGGCGTTTCTCCACGTTCATTTGTGTGTGAATTTTTAATATAAATGCAAGATGGAAAGCATTAATGCAAGCAAAATGTTTCAGTGAACACATTTCAACAGTTCAACTTTATAACAATTATAAATAAACCTGTTAAAATTTTCTGGACAATGCCAGCATTTGGATTTTTTTAAAATAAGTAAATTTCTTATTGACGGCAACTAAATGGTGTTTGTAGCATTTTTATCACACAGTAGATTCCATCCATTCACTATACTTTTCTAACTGAGTTGTCCTACATACAAGTACATGTTTTTAATGTTGTCAGTCTTCTGTGCTGTTCCTGTAAGTTTGCTATTAAAATACATTAAACTATA